ID: 1157245672

View in Genome Browser
Species Human (GRCh38)
Location 18:46052177-46052199
Sequence CAAATATAGAACTAGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157245670_1157245672 -7 Left 1157245670 18:46052161-46052183 CCACTACTGTCAAAAGCAAATAT 0: 1
1: 0
2: 2
3: 26
4: 246
Right 1157245672 18:46052177-46052199 CAAATATAGAACTAGGAGCTAGG 0: 1
1: 0
2: 0
3: 15
4: 166
1157245669_1157245672 17 Left 1157245669 18:46052137-46052159 CCAGGTCAAACAACAAATGTGCT 0: 1
1: 0
2: 0
3: 6
4: 129
Right 1157245672 18:46052177-46052199 CAAATATAGAACTAGGAGCTAGG 0: 1
1: 0
2: 0
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157245672 Original CRISPR CAAATATAGAACTAGGAGCT AGG Intronic
900456901 1:2779616-2779638 TAAAAATAGAACTACCAGCTGGG - Intronic
902910664 1:19594678-19594700 AAAATAGAGAACTAGGAGAAGGG + Intergenic
904999231 1:34655336-34655358 AAATTAGCGAACTAGGAGCTGGG + Intergenic
906821885 1:48938723-48938745 CAAATAGAGAACTGGGAGAAGGG - Intronic
908681591 1:66667765-66667787 CAAGTTTAGTACTAGGAGTTGGG - Intronic
909137247 1:71816996-71817018 CAAATAAAGGAATGGGAGCTAGG - Intronic
910577591 1:88783742-88783764 AAAATAAAGAACTATGAGTTAGG - Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
913242843 1:116844732-116844754 CAAATATAAAATTAGGTTCTAGG - Intergenic
913447113 1:118961296-118961318 CAAATATGGTATTAGGTGCTGGG - Intronic
914999215 1:152572912-152572934 CACATATAGAAAGAGGAGATGGG + Intronic
915917337 1:159948470-159948492 CAGATATAGAAATATGAGATGGG - Intergenic
916481784 1:165220841-165220863 CAAAATTAGAACTAGGATCCAGG - Intronic
918422831 1:184381413-184381435 TAAAAATAGAAAAAGGAGCTGGG + Intergenic
922175800 1:223196204-223196226 CAGCTATAGAACTAGGTGCCTGG - Intergenic
923209908 1:231794309-231794331 GCAATTTAGAACTAGGAGATTGG - Intronic
924318130 1:242819840-242819862 CAAATACAGAAATAGGAGCCAGG + Intergenic
1063967265 10:11356078-11356100 CAAATGGAGAATTAAGAGCTGGG - Intergenic
1064394649 10:14971820-14971842 TAAATCTAGAAATTGGAGCTGGG + Intronic
1064693396 10:17940867-17940889 CAAATATAGTACTAGATGCCAGG + Intergenic
1068403729 10:56563727-56563749 GAAATATATAACCAGGAACTAGG + Intergenic
1073018376 10:100420254-100420276 CAGAAATAGAACTAGGAGAAGGG + Intergenic
1074168629 10:110909634-110909656 TGAACAGAGAACTAGGAGCTAGG - Intronic
1076255670 10:129022562-129022584 TACATATAGAACTTGGGGCTCGG + Intergenic
1079363297 11:19787750-19787772 CAAATCTAGGACTTGGAGCTGGG + Intronic
1081929132 11:46856209-46856231 CAAGGCTAGAACAAGGAGCTAGG - Intergenic
1082110088 11:48264611-48264633 CTAATATAGACCAAGGAGCAAGG - Exonic
1085656256 11:78317997-78318019 CAAATATTGTACTAAGGGCTGGG + Intronic
1086096522 11:83055358-83055380 CAATTATAGAACCATGAACTTGG + Intronic
1088330530 11:108646393-108646415 CAAATATAGCATTAACAGCTGGG + Intergenic
1088585786 11:111359126-111359148 CAATTCTAGGACAAGGAGCTGGG - Intronic
1089934153 11:122346135-122346157 CTAATTTAGAAATAGAAGCTTGG - Intergenic
1095741669 12:45613782-45613804 CAAATATTGGGCTAGGAGCTGGG - Intergenic
1096754174 12:53785104-53785126 CAAAATTAGAAGCAGGAGCTGGG - Intergenic
1099261840 12:80392047-80392069 CACATATAGAACTATTAGGTTGG - Intergenic
1100194216 12:92225659-92225681 AAAAAAAAGAAATAGGAGCTGGG + Intergenic
1100370492 12:93964858-93964880 AAAAAAAAGAATTAGGAGCTGGG + Intergenic
1100675556 12:96863130-96863152 CAAATATAGACCTATGTGCCAGG - Intronic
1102079172 12:110084276-110084298 CAAATATTGAAATAGGAGGCAGG + Intergenic
1102091950 12:110198005-110198027 CAAATAAAGAAATAAGGGCTGGG - Intronic
1107781839 13:43911970-43911992 TAAATATAGAACTAGTCTCTTGG - Intergenic
1109377128 13:61510961-61510983 GAAATATGGAAGTAGGGGCTTGG - Intergenic
1109724910 13:66327297-66327319 CAAATATGGAACTAGATACTGGG - Intronic
1113367127 13:109686965-109686987 AAAATTTAGAAATTGGAGCTGGG + Intergenic
1113465121 13:110507337-110507359 CAAAAATAGATCTAGGAACAGGG + Intronic
1115063962 14:29232033-29232055 CATATATAGAAAAAGGAGCATGG + Intergenic
1120159689 14:81131935-81131957 CAAGTATAGTTCTAGAAGCTAGG - Intronic
1122185457 14:99989843-99989865 CAAGTATAAAAGCAGGAGCTGGG - Intronic
1126313337 15:47341098-47341120 CAAAAATAGAGTTAGGGGCTGGG + Intronic
1126773886 15:52083097-52083119 CAAAAATAGAAAAAGTAGCTGGG - Intergenic
1126786401 15:52180464-52180486 CAAAAATAAAACTAGTTGCTGGG + Intronic
1129417476 15:75394260-75394282 TATAAATAGTACTAGGAGCTAGG - Intronic
1132332421 15:101022060-101022082 CAAATCTGGAACCTGGAGCTGGG - Intronic
1133792733 16:9021715-9021737 AATATATAGAACTAGTTGCTAGG + Intergenic
1134398473 16:13887341-13887363 CCAATTAAGAACTAGGAGATTGG + Intergenic
1135649033 16:24189341-24189363 TAAATAAAGAAGTAGCAGCTCGG + Intronic
1136491718 16:30612799-30612821 CATACATAGAAGTAGGGGCTAGG - Intronic
1139258333 16:65565135-65565157 CAAATGTAGAAATAGTGGCTTGG - Intergenic
1140841868 16:78847178-78847200 CATATTTAGAACTAAGATCTAGG + Intronic
1141332058 16:83119857-83119879 CAAATATAGAAGTAGACACTTGG + Intronic
1145071619 17:19814570-19814592 CAAAAATAGAAAAAGTAGCTGGG - Intronic
1147856658 17:43485588-43485610 CAAATATTGAGCTGGGGGCTAGG + Intronic
1149273191 17:55004880-55004902 CAAATAAAGAGCTTGGAGCTGGG + Intronic
1149523762 17:57338515-57338537 TAAATAAAGAATAAGGAGCTTGG + Intronic
1153413540 18:4820774-4820796 CAAACACAGCACTAGTAGCTGGG - Intergenic
1156209782 18:34927085-34927107 CAAATAAAGAAATAGGAGAGAGG + Intergenic
1156817859 18:41333459-41333481 CAAATATATAACTATCAGATGGG + Intergenic
1157245672 18:46052177-46052199 CAAATATAGAACTAGGAGCTAGG + Intronic
1160978327 19:1805134-1805156 CAAAAATAAAACAAGTAGCTGGG - Intronic
1162198271 19:9002529-9002551 TAAAAATAGAACTATGAGCCGGG + Intergenic
1162247765 19:9416830-9416852 CAAAAATACAACTATTAGCTGGG - Intronic
1162816118 19:13195810-13195832 CAAATCTAGAACTCGAGGCTGGG - Intergenic
1165215803 19:34271563-34271585 CATTGAAAGAACTAGGAGCTGGG + Intronic
1165800253 19:38545192-38545214 CACCTATAGAACCAGGAGGTAGG + Intronic
1167673150 19:50867496-50867518 GGAATATAGAACCTGGAGCTTGG + Intronic
1168648478 19:58077176-58077198 CAAAGATAAAATTAGGCGCTTGG - Intronic
927057027 2:19374836-19374858 CAAAGACAGAAATAGGTGCTGGG - Intergenic
929817225 2:45242913-45242935 CAAATACAAAATTAGGAGCAGGG + Intergenic
936891889 2:117380149-117380171 CTAATGTAGAAGTAGGAGCAAGG - Intergenic
937899170 2:127004176-127004198 AAAATTTACAACTAGGAGCTGGG - Intergenic
941442493 2:165555562-165555584 CAGATACTGGACTAGGAGCTGGG + Intronic
942947608 2:181686604-181686626 CAAATGTAGATCTCGGAGTTTGG + Intergenic
946007264 2:216535945-216535967 CAAACATAAAATTAGGAGTTAGG + Intronic
946728520 2:222685984-222686006 GAAATATTGAATTAGTAGCTTGG + Intronic
946978011 2:225174835-225174857 CAAATATAAAAGCAGGAGCCAGG + Intergenic
1168879145 20:1191926-1191948 AAAATATATAACTAGCGGCTGGG + Intergenic
1169418321 20:5437207-5437229 CAAAAACAGATCTGGGAGCTAGG + Intergenic
1170616410 20:17956070-17956092 CAAAAATAGAATTTGGGGCTGGG - Intronic
1172368409 20:34367356-34367378 CTAATTTAGAACTTGGAGTTTGG + Intronic
1172415118 20:34759200-34759222 AAAATATAGAACGATTAGCTGGG - Intronic
1174431242 20:50471033-50471055 CAAAGACAGTGCTAGGAGCTGGG + Intergenic
1174606424 20:51765179-51765201 CTGAAATAGAACTAGGGGCTGGG - Intronic
1177147178 21:17419463-17419485 CAAATATAGAAGAATGTGCTAGG - Intergenic
1179072581 21:38085635-38085657 CAAATTTAGAACCAAGATCTGGG + Intronic
1180884048 22:19227197-19227219 TAAATACAGAACTAGGAGTTGGG + Intronic
1180915696 22:19484894-19484916 AAAAAATAGAACAAAGAGCTGGG - Intronic
949099155 3:122765-122787 GAAATATACACCTAGGAGTTTGG + Intergenic
950183351 3:10930244-10930266 CAAACAAAGTGCTAGGAGCTGGG - Intronic
951531674 3:23704118-23704140 CAAAAAAAGAACAAGGAGCTTGG + Intergenic
951701920 3:25505389-25505411 CTAATATAGAGCAAGGAGCATGG - Intronic
954808482 3:53233740-53233762 CAAATATACAGGAAGGAGCTGGG + Intronic
956179549 3:66504361-66504383 CAAATAGAAAACAAGGGGCTGGG + Intergenic
957833985 3:85562061-85562083 CAACCATAGTACTTGGAGCTAGG + Intronic
959062555 3:101629150-101629172 AAAAAATAGAAATAGGGGCTTGG + Intergenic
959981272 3:112520399-112520421 CAGATATAAAACCAGGAGTTTGG + Intergenic
960026961 3:113020414-113020436 CAAAGCTAGAACTAGAACCTTGG - Intergenic
960728743 3:120700439-120700461 CAAATAAAGTGCTAGGAGGTTGG + Intronic
962048233 3:131784233-131784255 CAAAGATAGAACAAAGGGCTAGG - Intronic
962284012 3:134071880-134071902 TAAAAATAAAACTAGGGGCTGGG + Intronic
964210868 3:154226553-154226575 CAAACACAGAACTAGAAGCCTGG - Intronic
967042897 3:185710134-185710156 AAAATCTAAAACTACGAGCTAGG - Intronic
968254567 3:197255506-197255528 CAAATATATACCTGGGAGGTAGG - Intronic
973265556 4:48206991-48207013 CAAATAAAGAACGAGGGGCAAGG + Intronic
974445527 4:61976097-61976119 CAAACACAGTACTAGGTGCTAGG + Intronic
977704723 4:100058393-100058415 GAAATATAGATATAGGTGCTTGG - Intergenic
978094530 4:104759583-104759605 CAGATTTAAAACTAGGAGTTGGG + Intergenic
981112798 4:140955395-140955417 CAAAAATAGGACAAAGAGCTGGG - Intronic
981247592 4:142557982-142558004 TAGATATAGAACTAGGAGTGAGG - Intronic
986956805 5:13160488-13160510 CACATAAATTACTAGGAGCTGGG - Intergenic
987018483 5:13845591-13845613 CAAATATAGAAATGAAAGCTCGG - Intronic
987110057 5:14677302-14677324 CAAATATTGAGCTAGGAACTGGG - Intronic
987348507 5:16999857-16999879 CAAATACAGAAAAAGTAGCTGGG + Intergenic
988476336 5:31589310-31589332 AAAATAGAGAACAAGGAGCAAGG + Intergenic
988485693 5:31666558-31666580 TAAAAATAGAACCATGAGCTGGG + Intronic
992323295 5:75635544-75635566 CAAAGTTAGAACAAGGAGCATGG + Intronic
993873723 5:93281610-93281632 CAAAAATAGAAGCAGGAGCATGG + Intergenic
995823968 5:116271905-116271927 CAAATATAAAACTGAGAGGTTGG - Intronic
999615915 5:153423973-153423995 CAGATAGAGAAATAGAAGCTTGG + Intergenic
999857669 5:155612829-155612851 CAAATATTGTAGTAGGTGCTTGG - Intergenic
1001854177 5:174996358-174996380 CAGATATAGAACCAGGAGAGAGG + Intergenic
1004485027 6:16058402-16058424 CAAATATAGAACTAAGGTCTTGG - Intergenic
1004945841 6:20611757-20611779 CAAATATACAACTAGAAGAGAGG - Intronic
1006459077 6:34147814-34147836 TAAATACAGTACTAGGTGCTGGG - Intronic
1008284549 6:49631691-49631713 CACAAATAGAACTAAGACCTTGG - Intronic
1008424156 6:51337471-51337493 CAAATAGAGAACTGGGACCATGG + Intergenic
1009689035 6:67003018-67003040 TGAATATACACCTAGGAGCTTGG - Intergenic
1012681519 6:102188339-102188361 CAAAGATAGAACTGGCAGCAGGG + Intergenic
1013557450 6:111270857-111270879 AAAATATTCAACTATGAGCTGGG + Exonic
1015830184 6:137360398-137360420 AAAATTTAGAAGTAGGAGCTGGG - Intergenic
1021248058 7:18289146-18289168 CAAATATAAAAATATGACCTTGG + Intronic
1022009317 7:26294874-26294896 CAAAATTTGAACTAGGAGCCTGG + Intronic
1022440759 7:30430921-30430943 CAAAAATAGAACCAGGAAGTGGG + Intronic
1023105918 7:36763220-36763242 CAAAAATATAGCTAGAAGCTGGG - Intergenic
1025720118 7:64002174-64002196 CATAAATAGTACAAGGAGCTGGG - Intergenic
1026187789 7:68095983-68096005 CAAATATATAATGAGGAGTTGGG - Intergenic
1026218694 7:68372673-68372695 CAAATTTGGACCTAGGGGCTGGG - Intergenic
1028006569 7:85577709-85577731 CAAATATTGGACTTGGAGATGGG - Intergenic
1028053746 7:86218435-86218457 CAAATATAGAAGTCGAGGCTGGG + Intergenic
1028394757 7:90356068-90356090 AAAAAATAGAACTAGGAATTTGG - Intronic
1031662636 7:124445148-124445170 AAAACATAGATATAGGAGCTTGG - Intergenic
1036069523 8:5425313-5425335 CAAATTTTGAAGTAGGAGCTTGG - Intergenic
1037333772 8:17771832-17771854 CACATACAGAACTAGTAGATTGG - Intronic
1037722104 8:21453497-21453519 CAAATATAGAATTGGGAGAAGGG - Intergenic
1040419582 8:47226147-47226169 CAAATGCTGCACTAGGAGCTGGG + Intergenic
1040563424 8:48545134-48545156 CACCTATAAAACAAGGAGCTTGG + Intergenic
1041784703 8:61618755-61618777 CAAAACTAGAATTAGAAGCTGGG + Intronic
1042960920 8:74302839-74302861 CAAATATGGCACTAGGCCCTGGG - Intronic
1044059401 8:87615729-87615751 TTAATATTGAACTAGGAACTAGG - Intergenic
1045794763 8:106029781-106029803 CAAATATAGAACTAATAGTGCGG - Intergenic
1048642405 8:136378851-136378873 CAAATATATTTCTAGGAGTTAGG - Intergenic
1049055913 8:140237508-140237530 CAAATTTAGGACTAGGAGCCAGG + Intronic
1049874914 8:145010783-145010805 TAAATATAGAACAATAAGCTAGG - Intergenic
1052066210 9:24023723-24023745 CAAATCTGAAACTAGGACCTAGG - Intergenic
1055235702 9:74120137-74120159 CAAATATATAACTTGATGCTGGG - Intergenic
1055289936 9:74771991-74772013 CCAATAAACAACTGGGAGCTGGG + Intronic
1058420779 9:104831195-104831217 CAAAAATAGAAAAAGGGGCTTGG - Intronic
1058582291 9:106471442-106471464 CAAAAATTGAACCAGGTGCTTGG + Intergenic
1058785649 9:108384188-108384210 CAAATATTGAATTAGGGGCCTGG + Intergenic
1058931346 9:109722474-109722496 TAAATATACAAATAGGAGCTAGG + Intronic
1061140862 9:128765657-128765679 GAAATATTAACCTAGGAGCTGGG + Intronic
1202798619 9_KI270719v1_random:151168-151190 AAAAAAAAAAACTAGGAGCTTGG - Intergenic
1185522754 X:754124-754146 AAAATATAGAATTTGGAGGTGGG - Intergenic
1188249429 X:27874704-27874726 CAGATATAGAAAGAGTAGCTGGG + Intergenic
1191056760 X:56249877-56249899 TAAATATATATATAGGAGCTTGG + Intronic
1193746851 X:85292512-85292534 CAAATGTACAAAGAGGAGCTGGG - Intronic
1194161036 X:90452884-90452906 CAAATACAAAACTCTGAGCTTGG - Intergenic
1195475372 X:105279175-105279197 AAATTATGGAACTAGGAGCTAGG + Intronic
1196799977 X:119533682-119533704 CAGATATTGCACTAGGAGCTGGG - Intergenic
1199596184 X:149507926-149507948 CAAACAAAGATCTAGGAGATGGG + Intronic
1200507325 Y:4029819-4029841 CAAATACAAAACTCTGAGCTTGG - Intergenic
1200919192 Y:8598059-8598081 AAAATAAAGAACAAAGAGCTGGG - Intergenic
1201221595 Y:11776351-11776373 CAAATACAGAAATAGAAGCCGGG + Intergenic