ID: 1157251230

View in Genome Browser
Species Human (GRCh38)
Location 18:46098079-46098101
Sequence CGCTCTCTGCAGGAGGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157251230_1157251240 15 Left 1157251230 18:46098079-46098101 CCCTCGCCCTCCTGCAGAGAGCG 0: 1
1: 0
2: 0
3: 18
4: 130
Right 1157251240 18:46098117-46098139 CACCACCCTGCAGCCCCACCCGG 0: 1
1: 0
2: 4
3: 57
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157251230 Original CRISPR CGCTCTCTGCAGGAGGGCGA GGG (reversed) Intronic
900156130 1:1203963-1203985 GGGTCTCTGCAGGGGGGCCACGG + Intronic
901032349 1:6314648-6314670 CACTCTATGCAGGAGGGTGGGGG + Intronic
903994427 1:27296855-27296877 CGCCCTCTGCTGGCTGGCGAGGG - Intronic
904678986 1:32215785-32215807 TGCCCTCTGCAGGAGGTGGAAGG - Exonic
908355721 1:63323510-63323532 CGGGCTCTGCAGGATGGCCATGG - Exonic
911002720 1:93182031-93182053 AGCTCTCTGTAGGATGGTGAAGG - Intronic
912348308 1:108987123-108987145 AGCTGGCTGCAGGAGGGCTAAGG - Intronic
912687666 1:111779769-111779791 CGCTGTCTGCAGGAGGATGTAGG + Intronic
915570898 1:156744547-156744569 GGCTCTGTGCAGGAGGGGGGAGG + Intronic
919978299 1:202627089-202627111 GGCTCTGTCCAGGAGGGCAAGGG + Intronic
1063821953 10:9846325-9846347 CTCTCTCTGCAGCAGAGAGAGGG - Intergenic
1073208525 10:101781098-101781120 CAGTCTCTGCAGGTGGGAGAGGG - Intergenic
1074108270 10:110404750-110404772 GGCTCTCAGCAGCAGGGTGAGGG - Intergenic
1076404985 10:130205722-130205744 CCCTCCCTGCAGGAAGGCGTAGG - Intergenic
1077485819 11:2837965-2837987 CTCTGTCTGCAGGAAGGAGAGGG + Intronic
1083988150 11:66230446-66230468 CTCTCTCTTCAGGATGGTGATGG + Intronic
1084480309 11:69416095-69416117 TGGGCTCTGCAGGAGGGCCAGGG - Intergenic
1084606012 11:70172257-70172279 CGATCTGTCCAGGAGGGTGAGGG + Intronic
1085595054 11:77801784-77801806 CGCTCTCTGGAGGAAGTGGATGG - Intronic
1085790474 11:79493443-79493465 CCCTCTCTGCAAGAGGGTGCTGG + Intergenic
1087225203 11:95591555-95591577 CTGTCTCTGCAGGAGAGAGAGGG + Intergenic
1089677050 11:120097127-120097149 CCCTCGCAGCAGGAGGGGGAAGG + Intergenic
1092061378 12:5553722-5553744 CGCTCTCTGCTGGAGGCCTAAGG - Intronic
1096684116 12:53276658-53276680 CTCCCTCAGCAGGAGGGCCAGGG - Exonic
1100158245 12:91827199-91827221 AGGTCTCTGAAGGAGGGAGAAGG - Intergenic
1101969725 12:109304647-109304669 GGCTGTGTGCAGGAGGGCGGGGG - Intronic
1104993696 12:132641265-132641287 CGCCCTCTGCAGCAGACCGACGG + Intronic
1106407178 13:29484299-29484321 CCTGCTCTGCAGGAGGGCTAAGG - Intronic
1113664651 13:112132820-112132842 AGCTCTGTGCAGTGGGGCGATGG - Intergenic
1113886151 13:113659267-113659289 CCATCTCTGCAGGAGGTTGATGG + Intergenic
1113926623 13:113945100-113945122 CGGGCTCTGCAGGTGTGCGAAGG + Intergenic
1118005813 14:61563407-61563429 CCCTCTCTGCTGGAGGGCTCTGG - Intronic
1118293808 14:64550143-64550165 CCGCCTCTGGAGGAGGGCGAGGG - Intronic
1119260939 14:73237740-73237762 CGCTCTCCGGAGGTGGGCGCAGG + Intronic
1119760832 14:77150604-77150626 CTCTCTCTGCTGGAGGGCAGTGG + Intronic
1121250877 14:92498434-92498456 AGCTCTTTGCAGCAAGGCGAAGG - Exonic
1122314543 14:100818002-100818024 GGCTCTCTGCAGGAGGAGGGAGG + Intergenic
1122791027 14:104184212-104184234 CGCTCCTTGCTGGAGGGCGGGGG + Intergenic
1122877226 14:104673799-104673821 GGCTGTCTGCAGGAGCGTGATGG + Intergenic
1124493929 15:30175027-30175049 GGCTCTGTCCAGGAGGGCAAGGG + Intergenic
1124749640 15:32363619-32363641 GGCTCTGTCCAGGAGGGCAAGGG - Intergenic
1127150618 15:56071344-56071366 TGCTCGCTCCAGGAGGGCGCGGG - Intergenic
1128727768 15:70000482-70000504 GGCTCTCAGCAGGAGGGAGAGGG - Intergenic
1131788688 15:95940649-95940671 TGGTCTCTTCAGGAGGGCGTTGG + Intergenic
1133019459 16:2960809-2960831 CTCTGTCTTCAGGAGGGCGGTGG - Intergenic
1138294448 16:55874304-55874326 CGCTCTCAGCAGAAGGGAGATGG - Intronic
1140829205 16:78735847-78735869 TGCTCTCTGCAACAGGGCCAGGG + Intronic
1141425245 16:83940596-83940618 GGCTCTCCCCAGGAGGGCGAGGG + Intronic
1142102843 16:88284767-88284789 GCAGCTCTGCAGGAGGGCGATGG + Intergenic
1142269036 16:89079581-89079603 CTGGCTCTGCAGGAGGGCGGAGG - Intergenic
1142485760 17:246892-246914 CGCTCTGTGCAGGAGTGCGGCGG - Intronic
1146198338 17:30832195-30832217 CGCTCTCTGTCGGTGGGCGCGGG + Exonic
1148136292 17:45294022-45294044 CACACGCTGCAGGAGGGAGAAGG - Intronic
1149998457 17:61417108-61417130 GGCTGGCGGCAGGAGGGCGAGGG - Intergenic
1150840545 17:68601669-68601691 TGCGCTCTGCAGGGGGGCGGAGG - Intergenic
1151436248 17:74099620-74099642 TGATCTCTGCAGGAGGGAAATGG - Intergenic
1151933153 17:77245469-77245491 GGCTCTGTGGAGGAGAGCGAGGG - Intergenic
1154023555 18:10685908-10685930 CCCTTTCTGCAGGATGGTGATGG + Intronic
1154332441 18:13440968-13440990 GGTTCTCTGCAGGAGCCCGAGGG + Intronic
1155392491 18:25351139-25351161 CGCGCTCTGCACGACGGCGGCGG + Intronic
1157251230 18:46098079-46098101 CGCTCTCTGCAGGAGGGCGAGGG - Intronic
1160202721 18:76808779-76808801 CTCTCTCTGCAGGGGTGCGTTGG - Intronic
1160454998 18:78993657-78993679 CACTCGCTGGAGGCGGGCGAGGG - Exonic
1161915408 19:7224613-7224635 CTGTCTCTGCCGGAGGGCGATGG + Intronic
1165782084 19:38440863-38440885 AGGTCTGTGCAGGAGGGAGAGGG + Exonic
1165822122 19:38683344-38683366 CTTTCTCTGGAGGAGGGCGGGGG - Intronic
1165845139 19:38813131-38813153 TCCTCTTTGCAGGAGGGCGTAGG - Exonic
1165905561 19:39192527-39192549 CCCTCTCTCCAGCAGGGGGATGG - Intergenic
1166094210 19:40529511-40529533 CGCTGGCTGCAGGAGGGCGCAGG - Intronic
1166796181 19:45427762-45427784 CGTTTTCTGCAAGGGGGCGATGG + Intronic
1168178946 19:54646487-54646509 AGCTCTCAGCAGAAGGGCGATGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
927945212 2:27131503-27131525 CACTCCCTGCAGGAGGGAAAGGG + Exonic
928182184 2:29076139-29076161 CACTGTCTGCAGGAGGGAGAGGG + Intergenic
929878132 2:45814046-45814068 CCCTCTGTGCGGGAGGGGGAGGG - Intronic
930169519 2:48236697-48236719 AGCTCTCTGAAAGAGGGCGGTGG - Intergenic
936043531 2:109168445-109168467 GGCTCTTGGCAGGAGGGAGAGGG + Intronic
936043538 2:109168475-109168497 GGCTCTCAGCAGGAGGGAGAGGG + Intronic
942799625 2:179861016-179861038 CGCTCTGCGGAGGAGGGCGGGGG + Intronic
944614202 2:201443355-201443377 CTCTCTCTCCAGGAGAGCCAAGG - Intronic
945092275 2:206186582-206186604 AGCTCACTGGAGGAGGGAGAGGG + Intronic
946277506 2:218642546-218642568 TGGTCTCTGCAGGAGAGCCAGGG + Exonic
947528791 2:230895557-230895579 CTCTCTCTGCAGGAGCCAGAAGG - Intergenic
948672814 2:239579350-239579372 CGCCCTCTGCAGAGGGACGAGGG + Intronic
948908548 2:240991629-240991651 TGCTCTCTGCCGGAGGGGAAGGG - Intronic
1173476510 20:43363676-43363698 CGCGCTCTGCACAAGGGCGGGGG - Intergenic
1174494689 20:50931208-50931230 CGCTGCCTGCGGGAGGGGGAGGG + Exonic
1175418397 20:58816378-58816400 GCCTCTCTGCAGGAGGCCGCTGG - Intergenic
1175490574 20:59378270-59378292 AGCTCCTTGCAAGAGGGCGATGG + Intergenic
1179824064 21:43954220-43954242 CCCTCCCTGCAGAAGGGTGACGG - Intronic
1179839091 21:44058724-44058746 GGCTCTCTGCTGGAGGCCGCAGG - Intronic
1181514425 22:23402872-23402894 CGGCCCCTGCAGGAGGCCGAGGG + Intergenic
1183976086 22:41513131-41513153 CCCTCTCTGCAGCAGGGTTAGGG + Intronic
1184246404 22:43237927-43237949 CCCTCTGTGCAGAAGGGTGAGGG - Intronic
949577096 3:5349019-5349041 CACTCTCTGCTGGAGGGTGATGG + Intergenic
949894681 3:8760374-8760396 AGCTGGCCGCAGGAGGGCGAGGG + Intronic
952906463 3:38142155-38142177 AGCTCTCTGCAGGTGGCCCAGGG - Exonic
954433189 3:50482235-50482257 TGCTGTTTGCAGCAGGGCGAGGG - Intronic
957040128 3:75329888-75329910 CACTCACTGCAGGAGGGCTTTGG + Intergenic
960435359 3:117619876-117619898 CCCTCTCTGTACGAGGGTGAGGG + Intergenic
960515226 3:118595758-118595780 AGCTCTCAGCAGAAGGGAGATGG + Intergenic
961593924 3:128001676-128001698 CTCTCTCTGCAGGTGAGGGATGG - Intergenic
963043995 3:141089203-141089225 TGCTCTCTTCAGGTGGACGAGGG + Intronic
963602646 3:147391395-147391417 CGCTCTCTGCACGAGGGAAAGGG - Intronic
965075108 3:163965789-163965811 CGCTCTCGGCTGGAGTGCGATGG + Intergenic
967417518 3:189235245-189235267 CCCTCACTGCAGTAGGGTGAAGG + Intronic
967438380 3:189477785-189477807 CCCTCTCTGCGGCAGGGCCAAGG - Intergenic
968916457 4:3499022-3499044 CACTCCCTGCAGCAGGGCTAGGG - Intronic
972541660 4:40044150-40044172 CGGTGGCTGCAGGAGGGCGCAGG + Intergenic
972740629 4:41882949-41882971 CGCCCTCTGCTGGAGCGCGCGGG + Intergenic
973712521 4:53643652-53643674 AGCTCTCAACAGGAGGGAGAAGG - Intronic
977994199 4:103483042-103483064 TGCTCCCTGCAGGAGGGTGGTGG - Intergenic
985836412 5:2275349-2275371 CTCTCTCTGCAGGAGGCTGTGGG - Intergenic
987258541 5:16180425-16180447 TGCTCACTGCAGGAGGGAGCGGG - Intronic
987296727 5:16559441-16559463 TGCTCTCTGCAGGAAGTGGATGG - Intronic
989581600 5:43038584-43038606 CTCGCTCTGCTGGAGGGCGTTGG + Intergenic
994944829 5:106374001-106374023 CGCTCTCTGCAGATGGAGGATGG - Intergenic
996488088 5:124059938-124059960 CTCTCTCTGCAGGAGCACAAAGG - Intergenic
997379316 5:133423997-133424019 CGCTGTGTGCACGAGGGCAAAGG + Intronic
997634966 5:135398521-135398543 CGCTATCTGCAGGGAGGGGAAGG - Intronic
999655827 5:153809720-153809742 AGCTTTCTGGAGGAGGGCAAGGG - Intronic
1003290222 6:4774460-4774482 CGCTGTTTGGAGGAGGGAGAGGG + Intronic
1013639691 6:112061119-112061141 GGCTCACTCCAGGAGGGCAACGG - Exonic
1019014603 6:168870880-168870902 TGCTCTCTGCAAGGGGGCTAAGG - Intergenic
1024472470 7:49777192-49777214 CGCCCTCTGCAGGTGGGAAAAGG - Intronic
1025078727 7:55964650-55964672 CGCCCGCTGCAGGAGGCCGCCGG - Exonic
1029129529 7:98319337-98319359 CGGTCTCTGCAGATGGGCCAGGG + Intronic
1029508960 7:100981353-100981375 CACTCGCTGCAGGAGGGACAAGG - Intronic
1029926960 7:104328606-104328628 CGCTCCCGGAAGGAGGGCGGGGG - Intergenic
1037461619 8:19116040-19116062 CCCTCTCTGCAGGAAGAAGAGGG + Intergenic
1037624324 8:20594113-20594135 CTCTCTCGGCAGAAGGGAGAGGG + Intergenic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1041407439 8:57515679-57515701 TGATCTCTGCTGGAGGGTGAAGG + Intergenic
1045459129 8:102411897-102411919 CGCTCCTTGCGGGAGGGGGAAGG + Intronic
1047400053 8:124538888-124538910 CGCTCAGTGGAGGAGGGCGCGGG - Intronic
1048243607 8:132768779-132768801 CCCCTTCTGCAGGAGGGAGAGGG - Intergenic
1048351464 8:133620004-133620026 GGGTCTCTTCAGGAGGGGGAAGG - Intergenic
1049775447 8:144401789-144401811 CCCTCTCTGCAGCAGGGAGAAGG + Intronic
1050528008 9:6562992-6563014 TTCACTCTGCAGGAGGGAGAGGG - Intronic
1059734410 9:117087026-117087048 CGTTCTCTGCAGGTTGGCAAAGG + Intronic
1060633227 9:125178770-125178792 AGCTGGCTGCAGGAGGGCTAAGG - Intronic
1062588698 9:137263402-137263424 CGCTACCTTCAGGAGGGCGGAGG - Intronic
1062699832 9:137893049-137893071 GGCTCTCTCCAGGAGGGCAAAGG + Intronic
1190762109 X:53445387-53445409 AACTCTCTGAAGGAGGGTGAAGG + Intergenic
1191257591 X:58286334-58286356 CGCACCCTGCATGAGGGCCAGGG + Intergenic
1193814080 X:86084668-86084690 CTCTTTCCGCATGAGGGCGAAGG + Intergenic
1194121670 X:89971023-89971045 AGGTCTCTGCAGGAAGGTGAGGG + Intergenic
1198321508 X:135521929-135521951 CGCTCTCAGCAGGAAGGGGAGGG - Intronic
1200474526 Y:3628474-3628496 AGGTCTCTGCAGGAGGGTGAGGG + Intergenic