ID: 1157257030

View in Genome Browser
Species Human (GRCh38)
Location 18:46148740-46148762
Sequence CCTGTTAACTACCCGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157257023_1157257030 11 Left 1157257023 18:46148706-46148728 CCCTCAAGAACTTTACACCCAAA No data
Right 1157257030 18:46148740-46148762 CCTGTTAACTACCCGAAGTCTGG No data
1157257021_1157257030 16 Left 1157257021 18:46148701-46148723 CCCTGCCCTCAAGAACTTTACAC No data
Right 1157257030 18:46148740-46148762 CCTGTTAACTACCCGAAGTCTGG No data
1157257022_1157257030 15 Left 1157257022 18:46148702-46148724 CCTGCCCTCAAGAACTTTACACC No data
Right 1157257030 18:46148740-46148762 CCTGTTAACTACCCGAAGTCTGG No data
1157257025_1157257030 -6 Left 1157257025 18:46148723-46148745 CCCAAAATGACCCAGATCCTGTT No data
Right 1157257030 18:46148740-46148762 CCTGTTAACTACCCGAAGTCTGG No data
1157257026_1157257030 -7 Left 1157257026 18:46148724-46148746 CCAAAATGACCCAGATCCTGTTA No data
Right 1157257030 18:46148740-46148762 CCTGTTAACTACCCGAAGTCTGG No data
1157257024_1157257030 10 Left 1157257024 18:46148707-46148729 CCTCAAGAACTTTACACCCAAAA No data
Right 1157257030 18:46148740-46148762 CCTGTTAACTACCCGAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157257030 Original CRISPR CCTGTTAACTACCCGAAGTC TGG Intergenic
No off target data available for this crispr