ID: 1157258152

View in Genome Browser
Species Human (GRCh38)
Location 18:46156634-46156656
Sequence ATTTACATTTAGTCTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157258152_1157258158 21 Left 1157258152 18:46156634-46156656 CCTGCCACAGACTAAATGTAAAT No data
Right 1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG No data
1157258152_1157258155 6 Left 1157258152 18:46156634-46156656 CCTGCCACAGACTAAATGTAAAT No data
Right 1157258155 18:46156663-46156685 CTTCTGCTGTGTCTTCAGTGAGG No data
1157258152_1157258157 20 Left 1157258152 18:46156634-46156656 CCTGCCACAGACTAAATGTAAAT No data
Right 1157258157 18:46156677-46156699 TCAGTGAGGATGGAGAACAGAGG No data
1157258152_1157258156 10 Left 1157258152 18:46156634-46156656 CCTGCCACAGACTAAATGTAAAT No data
Right 1157258156 18:46156667-46156689 TGCTGTGTCTTCAGTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157258152 Original CRISPR ATTTACATTTAGTCTGTGGC AGG (reversed) Intergenic
No off target data available for this crispr