ID: 1157258154

View in Genome Browser
Species Human (GRCh38)
Location 18:46156662-46156684
Sequence CTCACTGAAGACACAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157258154_1157258157 -8 Left 1157258154 18:46156662-46156684 CCTTCTGCTGTGTCTTCAGTGAG No data
Right 1157258157 18:46156677-46156699 TCAGTGAGGATGGAGAACAGAGG No data
1157258154_1157258161 23 Left 1157258154 18:46156662-46156684 CCTTCTGCTGTGTCTTCAGTGAG No data
Right 1157258161 18:46156708-46156730 AGGTCAAGTTGTATACTTGGAGG No data
1157258154_1157258160 20 Left 1157258154 18:46156662-46156684 CCTTCTGCTGTGTCTTCAGTGAG No data
Right 1157258160 18:46156705-46156727 TCAAGGTCAAGTTGTATACTTGG No data
1157258154_1157258162 27 Left 1157258154 18:46156662-46156684 CCTTCTGCTGTGTCTTCAGTGAG No data
Right 1157258162 18:46156712-46156734 CAAGTTGTATACTTGGAGGCTGG No data
1157258154_1157258158 -7 Left 1157258154 18:46156662-46156684 CCTTCTGCTGTGTCTTCAGTGAG No data
Right 1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG No data
1157258154_1157258159 3 Left 1157258154 18:46156662-46156684 CCTTCTGCTGTGTCTTCAGTGAG No data
Right 1157258159 18:46156688-46156710 GGAGAACAGAGGGCTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157258154 Original CRISPR CTCACTGAAGACACAGCAGA AGG (reversed) Intergenic
No off target data available for this crispr