ID: 1157258155

View in Genome Browser
Species Human (GRCh38)
Location 18:46156663-46156685
Sequence CTTCTGCTGTGTCTTCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157258152_1157258155 6 Left 1157258152 18:46156634-46156656 CCTGCCACAGACTAAATGTAAAT No data
Right 1157258155 18:46156663-46156685 CTTCTGCTGTGTCTTCAGTGAGG No data
1157258151_1157258155 10 Left 1157258151 18:46156630-46156652 CCTTCCTGCCACAGACTAAATGT No data
Right 1157258155 18:46156663-46156685 CTTCTGCTGTGTCTTCAGTGAGG No data
1157258153_1157258155 2 Left 1157258153 18:46156638-46156660 CCACAGACTAAATGTAAATAAAG No data
Right 1157258155 18:46156663-46156685 CTTCTGCTGTGTCTTCAGTGAGG No data
1157258149_1157258155 27 Left 1157258149 18:46156613-46156635 CCCTTCAGTGGATGGGTCCTTCC No data
Right 1157258155 18:46156663-46156685 CTTCTGCTGTGTCTTCAGTGAGG No data
1157258150_1157258155 26 Left 1157258150 18:46156614-46156636 CCTTCAGTGGATGGGTCCTTCCT No data
Right 1157258155 18:46156663-46156685 CTTCTGCTGTGTCTTCAGTGAGG No data
1157258148_1157258155 28 Left 1157258148 18:46156612-46156634 CCCCTTCAGTGGATGGGTCCTTC No data
Right 1157258155 18:46156663-46156685 CTTCTGCTGTGTCTTCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157258155 Original CRISPR CTTCTGCTGTGTCTTCAGTG AGG Intergenic
No off target data available for this crispr