ID: 1157258156

View in Genome Browser
Species Human (GRCh38)
Location 18:46156667-46156689
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157258150_1157258156 30 Left 1157258150 18:46156614-46156636 CCTTCAGTGGATGGGTCCTTCCT No data
Right 1157258156 18:46156667-46156689 TGCTGTGTCTTCAGTGAGGATGG No data
1157258152_1157258156 10 Left 1157258152 18:46156634-46156656 CCTGCCACAGACTAAATGTAAAT No data
Right 1157258156 18:46156667-46156689 TGCTGTGTCTTCAGTGAGGATGG No data
1157258153_1157258156 6 Left 1157258153 18:46156638-46156660 CCACAGACTAAATGTAAATAAAG No data
Right 1157258156 18:46156667-46156689 TGCTGTGTCTTCAGTGAGGATGG No data
1157258151_1157258156 14 Left 1157258151 18:46156630-46156652 CCTTCCTGCCACAGACTAAATGT No data
Right 1157258156 18:46156667-46156689 TGCTGTGTCTTCAGTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157258156 Original CRISPR TGCTGTGTCTTCAGTGAGGA TGG Intergenic
No off target data available for this crispr