ID: 1157258157

View in Genome Browser
Species Human (GRCh38)
Location 18:46156677-46156699
Sequence TCAGTGAGGATGGAGAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157258154_1157258157 -8 Left 1157258154 18:46156662-46156684 CCTTCTGCTGTGTCTTCAGTGAG No data
Right 1157258157 18:46156677-46156699 TCAGTGAGGATGGAGAACAGAGG No data
1157258151_1157258157 24 Left 1157258151 18:46156630-46156652 CCTTCCTGCCACAGACTAAATGT No data
Right 1157258157 18:46156677-46156699 TCAGTGAGGATGGAGAACAGAGG No data
1157258152_1157258157 20 Left 1157258152 18:46156634-46156656 CCTGCCACAGACTAAATGTAAAT No data
Right 1157258157 18:46156677-46156699 TCAGTGAGGATGGAGAACAGAGG No data
1157258153_1157258157 16 Left 1157258153 18:46156638-46156660 CCACAGACTAAATGTAAATAAAG No data
Right 1157258157 18:46156677-46156699 TCAGTGAGGATGGAGAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157258157 Original CRISPR TCAGTGAGGATGGAGAACAG AGG Intergenic
No off target data available for this crispr