ID: 1157260719

View in Genome Browser
Species Human (GRCh38)
Location 18:46173885-46173907
Sequence TCCTCCCGCTGCAGACCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157260719_1157260724 2 Left 1157260719 18:46173885-46173907 CCCCGCGGTCTGCAGCGGGAGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1157260724 18:46173910-46173932 GCGGGTTCCATCGCGCCAGATGG 0: 1
1: 0
2: 0
3: 1
4: 26
1157260719_1157260726 12 Left 1157260719 18:46173885-46173907 CCCCGCGGTCTGCAGCGGGAGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1157260726 18:46173920-46173942 TCGCGCCAGATGGCGCTGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 32
1157260719_1157260729 23 Left 1157260719 18:46173885-46173907 CCCCGCGGTCTGCAGCGGGAGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1157260729 18:46173931-46173953 GGCGCTGTCTGGCTTTTCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 124
1157260719_1157260728 22 Left 1157260719 18:46173885-46173907 CCCCGCGGTCTGCAGCGGGAGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1157260728 18:46173930-46173952 TGGCGCTGTCTGGCTTTTCTCGG 0: 1
1: 0
2: 1
3: 12
4: 479
1157260719_1157260731 30 Left 1157260719 18:46173885-46173907 CCCCGCGGTCTGCAGCGGGAGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1157260731 18:46173938-46173960 TCTGGCTTTTCTCGGGCCTCGGG 0: 1
1: 0
2: 0
3: 16
4: 140
1157260719_1157260730 29 Left 1157260719 18:46173885-46173907 CCCCGCGGTCTGCAGCGGGAGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1157260730 18:46173937-46173959 GTCTGGCTTTTCTCGGGCCTCGG 0: 1
1: 0
2: 0
3: 5
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157260719 Original CRISPR TCCTCCCGCTGCAGACCGCG GGG (reversed) Intronic