ID: 1157260918

View in Genome Browser
Species Human (GRCh38)
Location 18:46174652-46174674
Sequence GTCCTTTTCCGGGGGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 132}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157260913_1157260918 -9 Left 1157260913 18:46174638-46174660 CCGGGTTGAGGCGAGTCCTTTTC 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1157260918 18:46174652-46174674 GTCCTTTTCCGGGGGTGCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 132
1157260905_1157260918 12 Left 1157260905 18:46174617-46174639 CCAAGCCCCCAGACGCTGGGGCC 0: 1
1: 0
2: 2
3: 30
4: 300
Right 1157260918 18:46174652-46174674 GTCCTTTTCCGGGGGTGCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 132
1157260908_1157260918 7 Left 1157260908 18:46174622-46174644 CCCCCAGACGCTGGGGCCGGGTT 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1157260918 18:46174652-46174674 GTCCTTTTCCGGGGGTGCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 132
1157260909_1157260918 6 Left 1157260909 18:46174623-46174645 CCCCAGACGCTGGGGCCGGGTTG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1157260918 18:46174652-46174674 GTCCTTTTCCGGGGGTGCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 132
1157260911_1157260918 4 Left 1157260911 18:46174625-46174647 CCAGACGCTGGGGCCGGGTTGAG 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1157260918 18:46174652-46174674 GTCCTTTTCCGGGGGTGCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 132
1157260910_1157260918 5 Left 1157260910 18:46174624-46174646 CCCAGACGCTGGGGCCGGGTTGA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1157260918 18:46174652-46174674 GTCCTTTTCCGGGGGTGCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 132
1157260901_1157260918 20 Left 1157260901 18:46174609-46174631 CCGGCACTCCAAGCCCCCAGACG 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1157260918 18:46174652-46174674 GTCCTTTTCCGGGGGTGCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157260918 Original CRISPR GTCCTTTTCCGGGGGTGCTG AGG Intronic
900528732 1:3142340-3142362 GCCCTGTCCCGGGGGTGCGGTGG + Intronic
903801831 1:25974640-25974662 GTCCTATTCCAGGTGTGCGGTGG - Exonic
906205538 1:43984602-43984624 GGCATATTCCGGGGCTGCTGAGG + Intronic
906825419 1:48974268-48974290 GTCCTATTCCTGGGGTAATGGGG - Intronic
910171983 1:84387449-84387471 GTCCTTTTCCGGGGAAAGTGGGG + Intronic
910200347 1:84691744-84691766 TTCCTTTCCCGGGGTTGCTGAGG - Intergenic
913597304 1:120390806-120390828 TTTCTTTTGCGGGGGTGCGGGGG + Intergenic
914090024 1:144488503-144488525 TTTCTTTTGCGGGGGTGCGGGGG - Intergenic
916718982 1:167469020-167469042 GTCTTTTTCCTGGAGTGCAGTGG + Intronic
919670218 1:200331354-200331376 GCCTTTTTCCGGGGTTGATGTGG - Intergenic
1065024143 10:21525810-21525832 CTGCTTTTCCTGGGCTGCTGGGG - Intergenic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1069526897 10:69180389-69180411 GGCCCTTTCCCGGGGTTCTGGGG + Exonic
1071646773 10:87364678-87364700 TGCCTCCTCCGGGGGTGCTGCGG + Intronic
1074082857 10:110181530-110181552 GTCATTTTCCAGGGGTCCTGGGG + Intergenic
1076112319 10:127870788-127870810 GTTCTTTTCAGGGGGAGGTGAGG + Intergenic
1076426738 10:130372404-130372426 CTCCTCCTCCGGGGCTGCTGTGG + Intergenic
1076751665 10:132546487-132546509 CTCCTCTTCAGGGGTTGCTGGGG + Intronic
1077614601 11:3666051-3666073 GTCCCTTTCTGGAGGAGCTGTGG + Exonic
1083724244 11:64620061-64620083 GTCCTTAGCCTGGGGTCCTGGGG - Intronic
1085412687 11:76300978-76301000 GTCCTTTTCAAGGGGTGGGGAGG - Intergenic
1088820657 11:113453922-113453944 GTCCTTTTGATGGGGGGCTGGGG + Intronic
1089776110 11:120837276-120837298 GTCCTTTCCAGGGGCTGCTGTGG + Intronic
1090925507 11:131246648-131246670 GGCCTTCTCCTGGGCTGCTGAGG - Intergenic
1094167915 12:27461564-27461586 CTCCTTATCCGTGGGTTCTGTGG - Intergenic
1098698468 12:73590778-73590800 GTCCTTTTCCGGCTGTATTGTGG - Intergenic
1103903674 12:124316404-124316426 GCCCTTCTCCAGGGATGCTGTGG - Intergenic
1104485508 12:129148546-129148568 GTCCTTTGCAGGGGGAGCTTAGG - Intronic
1105433420 13:20357864-20357886 GTCCTATTCAGGCAGTGCTGGGG + Intergenic
1108144579 13:47463516-47463538 CTCCTTTGGCGGGGGTGCTGGGG - Intergenic
1111678504 13:91415731-91415753 GTCTTTTTGCGGGGGTGGGGGGG + Intronic
1119071392 14:71588349-71588371 GAGCTTTTCTGGGGGAGCTGGGG - Exonic
1119434048 14:74586379-74586401 TTCCTCTTCAGGGTGTGCTGTGG - Intronic
1119998370 14:79277786-79277808 GGCCATTTCCTGGGGGGCTGTGG + Intronic
1122919722 14:104875023-104875045 GCCCTTGCCCAGGGGTGCTGGGG + Intronic
1122995612 14:105262215-105262237 GTCCTGCTCTTGGGGTGCTGAGG - Intronic
1123055173 14:105566125-105566147 ATCCTCTTCCGAGGGTGCTGGGG + Intergenic
1123079622 14:105685969-105685991 ATCCTCTTCCGAGGGTGCTGGGG + Intergenic
1123190449 14:106564487-106564509 GTCCCTTCCCTGGGGAGCTGAGG + Intergenic
1128099531 15:64987676-64987698 GCCCTCTTCAGGGTGTGCTGTGG + Intronic
1129176299 15:73841954-73841976 TTCCTTTGCAGGGGGTGCTGGGG + Intergenic
1131875457 15:96801565-96801587 CTCTGTTTCCGGGGCTGCTGAGG + Intergenic
1132674416 16:1115728-1115750 GTCCTTCTCTTGGGGTGTTGGGG + Intergenic
1133583400 16:7167912-7167934 GTGCTTGTCTGGGGATGCTGCGG + Intronic
1133998659 16:10766137-10766159 GTCCTGGTCCCGGTGTGCTGAGG + Intronic
1137496048 16:48970247-48970269 GGCCTTTTCTTGGGATGCTGAGG + Intergenic
1137627010 16:49915476-49915498 GTCCTTTTCAGTGGCTGCTGTGG - Intergenic
1138414228 16:56862198-56862220 CTCCTCTTCCAGAGGTGCTGGGG - Intergenic
1141372864 16:83503550-83503572 TTCCTTTTCCTGGGGTGGAGTGG + Intronic
1141567338 16:84911533-84911555 GTCCTTTTCCATGCGTGATGGGG + Intronic
1141720526 16:85752819-85752841 GGCCATTTCCTGGGCTGCTGAGG + Intergenic
1142509501 17:385334-385356 GGCCTCTGCCGGGGGCGCTGGGG - Intronic
1142618118 17:1148471-1148493 GTCCATGCCCGGGGGGGCTGGGG - Intronic
1142643957 17:1300295-1300317 GTCCTCTCCCTGGGTTGCTGAGG - Exonic
1148642886 17:49201497-49201519 TTACTTTTCCAGAGGTGCTGAGG + Intergenic
1148936435 17:51167111-51167133 GACCCTTTCCCGGGGTGGTGGGG + Intronic
1151389054 17:73773293-73773315 GTCGTTTTCCTGGGGCGCTGGGG + Intergenic
1151935058 17:77256478-77256500 CTCCTTTGCCAGGGGTGCTCGGG - Intergenic
1152474514 17:80509264-80509286 TGCCTTTTCTGGGGGTTCTGGGG + Intergenic
1155355039 18:24943794-24943816 GACCTTTTTCGGGGGGGGTGGGG - Intergenic
1155521642 18:26674331-26674353 TTCCTTTTCCAGGGGTCCTTAGG - Intergenic
1155904304 18:31430346-31430368 GTCCTGTTCCAGCGGTGGTGGGG + Intergenic
1157260918 18:46174652-46174674 GTCCTTTTCCGGGGGTGCTGAGG + Intronic
1158652863 18:59303221-59303243 GTCCTACTCTAGGGGTGCTGAGG - Intronic
1159066584 18:63574817-63574839 GTTCTTTTCAGGGGGTGATGGGG + Intergenic
1160716402 19:578709-578731 AGCCTTGGCCGGGGGTGCTGTGG + Intronic
1160801592 19:972873-972895 GTCCATTTCTGGGGGTGCGTTGG + Exonic
1167562257 19:50232899-50232921 GACTTTGTCCTGGGGTGCTGGGG + Intronic
1167619977 19:50555337-50555359 GTCCTCTCCCGGGGCAGCTGCGG - Intronic
1168104175 19:54156570-54156592 CACCCTTTCCCGGGGTGCTGTGG - Intronic
926170585 2:10550480-10550502 AGCATTTTCAGGGGGTGCTGGGG - Intergenic
927834040 2:26377340-26377362 GTACTTTTCCCTGGGTGCGGTGG + Intronic
929851666 2:45597053-45597075 GTCCAGTGCCTGGGGTGCTGAGG - Intronic
931801879 2:65766616-65766638 GTCCTTTTTGGGGGGTGGGGTGG + Intergenic
932447951 2:71792085-71792107 CTCCTTTTCTGGGTGGGCTGGGG - Intergenic
933942978 2:87260514-87260536 GTCCTGTTCAGGGAGGGCTGAGG + Intergenic
936337235 2:111601048-111601070 GTCCTGTTCAGGGAGGGCTGAGG - Intergenic
1171422095 20:25024341-25024363 CTCCTTTTCCTGGGGTCTTGAGG - Intronic
1172005833 20:31818784-31818806 GTCCTTTTCTTGGGCTCCTGGGG - Intergenic
1172207820 20:33176862-33176884 GACCTTTGCCTGGGGTGCTCTGG + Intronic
1173361317 20:42346959-42346981 GCCCTTTTGTGGGGGTGCTACGG - Intronic
1175161822 20:57013913-57013935 GACCTTTCCCTCGGGTGCTGAGG + Intergenic
1175192958 20:57223885-57223907 GTCCTCTCCTGGGGATGCTGGGG - Intronic
1175913709 20:62416103-62416125 GTGCTGCTCGGGGGGTGCTGGGG + Intronic
1175920452 20:62448285-62448307 GGCCACTTCCTGGGGTGCTGGGG + Intergenic
1179569323 21:42268844-42268866 GTCCTGTTCCTGGGGTCCTGGGG + Intronic
1183057266 22:35314616-35314638 ATCGTTTTCAGGGGGTACTGGGG + Intronic
1185080171 22:48705287-48705309 GTCCTCTGCCGTGGGTGCTGTGG + Intronic
1185241837 22:49750881-49750903 GGCCTTTCCCGGGGCTGGTGGGG - Intergenic
950457197 3:13099836-13099858 GCCCTCTGCCAGGGGTGCTGAGG - Intergenic
954618232 3:51981205-51981227 TTCCGTTTCCTGGTGTGCTGTGG + Intronic
956713111 3:72055769-72055791 ACTCTATTCCGGGGGTGCTGTGG - Intergenic
956755237 3:72379349-72379371 CTCCTTTTTAGGGGGTGGTGGGG + Exonic
957078043 3:75617110-75617132 CACCTTATCCGGGGGTGATGGGG + Intergenic
962371888 3:134827708-134827730 CTCCTTTCCCTGGGGAGCTGGGG + Intronic
968872433 4:3248674-3248696 GTCCTGGTCCTGGGGTCCTGGGG - Exonic
970425387 4:15941022-15941044 GTCCTTTTCCAGTGGCTCTGGGG + Intergenic
975710914 4:77158414-77158436 CTCCTTGTCGGGGTGTGCTGGGG + Intronic
979508788 4:121528054-121528076 GTCATTTCCTGGGAGTGCTGGGG - Intergenic
980997827 4:139797747-139797769 GTCTTTTTTGGGGGGTGCAGGGG - Intronic
986292449 5:6411131-6411153 CTCCTTTCCCGCGGGTGGTGTGG + Intergenic
990325656 5:54672808-54672830 GACATTTTCCAGGAGTGCTGGGG + Intergenic
999282977 5:150376890-150376912 GCCCTTGTCTGGGGTTGCTGAGG + Intronic
999283985 5:150383102-150383124 GTTCCTCTCTGGGGGTGCTGGGG - Intronic
1000286942 5:159834905-159834927 GTCCTTTTGCGGCGGGGGTGGGG - Intergenic
1002273778 5:178090363-178090385 CAGCTATTCCGGGGGTGCTGAGG + Intergenic
1005870640 6:29972154-29972176 GACCTTTTCCAGGAGAGCTGGGG - Intergenic
1007368818 6:41413053-41413075 GGCCTTTCCCTGGGGAGCTGGGG + Intergenic
1007369086 6:41414442-41414464 GGCCTTTCCCTGGGGAGCTGGGG - Intergenic
1007904634 6:45447046-45447068 TACCTTTTCCAGGGGTGCTTGGG - Intronic
1010496501 6:76539060-76539082 TTCCTTTTCTTGGGGTGCTCAGG + Intergenic
1013492033 6:110657234-110657256 TTCATTTTCCCAGGGTGCTGTGG - Intronic
1014141967 6:117954057-117954079 TTCCTTTTCTGGAGTTGCTGAGG - Intronic
1014757002 6:125312432-125312454 TTGCTTTTCCTGGGGTTCTGGGG - Intergenic
1015504269 6:133965528-133965550 GTTCTTTTTTGGTGGTGCTGAGG - Intronic
1018580808 6:165307220-165307242 GTCCTATTCTGGGGTTGGTGGGG - Intronic
1019902141 7:4029124-4029146 GACCTTTTCCGAGGGGGGTGGGG + Intronic
1023082187 7:36536135-36536157 GTCCTGCTGCGTGGGTGCTGTGG + Intronic
1023411122 7:39890266-39890288 GTACTTTTCGGGGAGTGGTGGGG - Intergenic
1023887803 7:44373628-44373650 GTCCCTATGCGGGGGAGCTGTGG + Intergenic
1023902155 7:44490293-44490315 CTCCTTTTCCTGGTGTCCTGGGG - Intronic
1024011604 7:45271608-45271630 TTCCTTGACCGGGGATGCTGGGG + Intergenic
1024778413 7:52816410-52816432 GGCCATTTCAGGGTGTGCTGTGG - Intergenic
1027263782 7:76482918-76482940 GTCCTGTGTGGGGGGTGCTGGGG - Exonic
1027315155 7:76981031-76981053 GTCCTGTGGGGGGGGTGCTGGGG - Intergenic
1031839149 7:126716489-126716511 GTCATTCTCCTTGGGTGCTGAGG + Intronic
1039544824 8:38402104-38402126 GGCCATTTCTGGGGGTGTTGGGG + Intronic
1041972784 8:63761723-63761745 CATCTTTTCCGGGGGTCCTGGGG + Intergenic
1042560724 8:70070758-70070780 ATCCTTTCCCGGCGGTGCGGGGG - Intronic
1045310203 8:100994572-100994594 GTGCTTTTCCAGGGCTGGTGTGG - Intergenic
1049426117 8:142538616-142538638 GTCCTTCTCCAGGGGCCCTGGGG - Intronic
1052798528 9:32946340-32946362 TTCCTTTTCCCGTGGTGCCGTGG - Intergenic
1060620701 9:125063098-125063120 GCCCTTTTCTGGGGGGGGTGGGG - Intronic
1061041810 9:128144953-128144975 GCCCCTTTCCTGGGGTGCTGGGG + Intergenic
1061935754 9:133856704-133856726 GTCCCTTTCAGGAGGTGCCGGGG + Intronic
1062000047 9:134211370-134211392 CTCCCTTGCTGGGGGTGCTGGGG + Intergenic
1062193492 9:135259640-135259662 GCCCTTTTCCGGGGGGGGGGGGG - Intergenic
1203770958 EBV:49925-49947 GTCCTGTTCCGGGGCGGCGGTGG + Intergenic
1187775202 X:22748845-22748867 GTTCATTTCAGGGGATGCTGAGG + Intergenic
1189756026 X:44272010-44272032 GTCCTTCTCTTGGGATGCTGCGG - Intronic
1192546472 X:72018660-72018682 CTCGTGTTCCGGAGGTGCTGAGG - Intergenic
1195091717 X:101466689-101466711 GTGGTTTTTTGGGGGTGCTGAGG + Intronic
1196179767 X:112677151-112677173 GTCTTTTTCTGTGGGTACTGGGG - Intronic
1196918036 X:120559905-120559927 TTCATTTTCCGGGGGTGGTTAGG - Intronic
1199434991 X:147802958-147802980 TTCCTTTTTCTGGGGTGCTAAGG + Intergenic
1200128410 X:153829023-153829045 GCCCTTCTCCGGGGGTGCGCGGG - Intronic