ID: 1157263890

View in Genome Browser
Species Human (GRCh38)
Location 18:46200086-46200108
Sequence GTGTGTGCGCGCGCGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 1, 2: 14, 3: 111, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157263887_1157263890 16 Left 1157263887 18:46200047-46200069 CCTTACAGAAAATTCTTTATTGT 0: 1
1: 0
2: 6
3: 55
4: 469
Right 1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG 0: 1
1: 1
2: 14
3: 111
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157263890 Original CRISPR GTGTGTGCGCGCGCGTGCTG GGG Intronic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
901361388 1:8703506-8703528 GTGTGTGCGCGCGCCCGCGGCGG - Intronic
901443876 1:9295236-9295258 GTGTGTGCGCGCGTGCGGTTGGG + Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
902391918 1:16111903-16111925 GTGTGTGTGTGCACGTGGTGGGG - Intergenic
902538350 1:17134889-17134911 GTGTGCGCGTGCGCATGCGGGGG - Intergenic
904697529 1:32338599-32338621 GTGTGTGTGCGCGTGTGCCCAGG + Intergenic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
905205049 1:36338686-36338708 GTGTGTCCGCGTGGGTGCTGTGG + Intergenic
905347270 1:37319536-37319558 GTGTGTGCGCGTGTGTGCCTGGG + Intergenic
905676408 1:39828461-39828483 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
905938168 1:41841172-41841194 GTGTGTGGGCAGGTGTGCTGGGG - Intronic
906077635 1:43063688-43063710 GTGTGTGTGCGCGCATGTAGGGG + Intergenic
906791937 1:48666513-48666535 GTGTGTGCACGTGCATGCTAAGG - Intronic
907526476 1:55056863-55056885 GTGCGTGCGCGCGCGCGCGTTGG + Intronic
907526478 1:55056865-55056887 GCGTGCGCGCGCGCGCGTTGGGG + Intronic
907656797 1:56351552-56351574 GTGTGTGTGCTCGTGCGCTGGGG + Intergenic
908252903 1:62279183-62279205 GTGTGTGCGCGCGCTAGCTTAGG - Intronic
910156539 1:84225437-84225459 CTGTGTGGGCTCGAGTGCTGGGG + Intronic
911102400 1:94104942-94104964 GTGTGTGTGTGCGTGTGTTGGGG - Intronic
912453910 1:109785287-109785309 GTGTGTGAGTGTGCGCGCTGAGG + Intergenic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
913319408 1:117577907-117577929 GTGTGCGCGCGCGCGCAATGAGG + Intergenic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
915722088 1:157993224-157993246 ATGTGTGTGCGCGCGTTGTGGGG + Intergenic
916945493 1:169722147-169722169 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
917565382 1:176207269-176207291 GTGCGCGCGCGCGCGAGCGGCGG + Exonic
918048346 1:180954407-180954429 ACGCGTGCGCGCGTGTGCTGGGG - Intergenic
918995793 1:191757538-191757560 GTGTGTGCGCGCGCGTGGGTGGG - Intergenic
919641904 1:200053554-200053576 GTGTGTGCGTGTGCATGCTGGGG - Intronic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920524997 1:206659793-206659815 GTGTGTGCGCGCGCACGCACCGG - Intronic
921334011 1:214068068-214068090 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
921708023 1:218346039-218346061 GTGTGCGTGTGCGCGCGCTGGGG - Intergenic
922648720 1:227318511-227318533 GTGTGCGCGCGCGTGTGCCGGGG - Intergenic
922648722 1:227318513-227318535 GCGTGTGCGCGCGCGTGTGCCGG - Intergenic
922817256 1:228458676-228458698 GTGTGTGTGCGCGCGCGCGCCGG + Exonic
923301935 1:232649394-232649416 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
923333951 1:232950783-232950805 GGGTGGGGGCGCGCGGGCTGCGG + Intronic
923783230 1:237043297-237043319 GTGTGCGCGCGCGCGGGTGGTGG + Intronic
924598055 1:245464455-245464477 ATGTGTGCGTGCGCGTGTGGGGG + Intronic
924799340 1:247316229-247316251 GTGTGTGTGAGCGCGCGCAGTGG + Intronic
924799342 1:247316231-247316253 GTGTGTGAGCGCGCGCAGTGGGG + Intronic
1062794861 10:337095-337117 GTGTGTGCGTGTGTGTGTTGTGG + Intronic
1062794889 10:337307-337329 GTGTGTGTGCACGTGTGTTGTGG + Intronic
1062794894 10:337344-337366 GTGTGCGCGCGTGTGTGTTGTGG + Intronic
1062794922 10:337622-337644 GTGTGTGCGCACGTGTGTTGTGG + Intronic
1062794927 10:337659-337681 GTGTGTACGCGTGTGTGTTGTGG + Intronic
1063382103 10:5591895-5591917 GTGTGCGCGTGCACGTGCAGAGG - Intergenic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1065099696 10:22321160-22321182 GTGTGTGTGCGTGCGAGCGGGGG - Intronic
1066022875 10:31319936-31319958 GTTTGTGCGCGCGTGTGCGCGGG + Intronic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1068519797 10:58065621-58065643 GTGTGTGCGCGCGCGTGTTTAGG + Intergenic
1068788259 10:61001082-61001104 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1068950132 10:62768489-62768511 GTGTGTGTGCGTGCGTGCGCTGG - Intergenic
1069653691 10:70071087-70071109 GTGTGTGTGCGCGTGTGCACAGG + Intronic
1069976286 10:72215993-72216015 GCGTGCGCGCGCCCGTGCCGTGG - Exonic
1070975154 10:80600537-80600559 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1072492961 10:95926868-95926890 GTGTGTGCGCGCGCCTGAACAGG + Intronic
1072881252 10:99232194-99232216 GTATGCGCGCGCGCGCGTTGGGG - Intronic
1072881254 10:99232196-99232218 GTGTATGCGCGCGCGCGCGTTGG - Intronic
1072930710 10:99659593-99659615 GTGTGGGCGCGAGAGGGCTGTGG + Intronic
1073073199 10:100807679-100807701 GTGTGGGAGCGGGTGTGCTGGGG - Intronic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073392586 10:103192263-103192285 GTGTGTGCGCGCCCGTCCAGGGG - Intronic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1074465580 10:113679043-113679065 GTGTGTGTGTGCGTATGCTGTGG + Intergenic
1075953442 10:126502045-126502067 GTGTGTGCGTGTGTGTGGTGTGG - Intronic
1076120589 10:127934011-127934033 GTGTGTGTGCGCGGGGGGTGGGG - Intronic
1076568821 10:131417916-131417938 GTGTGTGTGTGCGCGTGCACAGG - Intergenic
1076670959 10:132120921-132120943 GTGTGTGGCCGCTCGAGCTGCGG + Intronic
1077020514 11:415305-415327 GTGTGTGTGCGTGTGTGTTGTGG + Intronic
1077044213 11:537335-537357 GTGCGTGGGCGCCCCTGCTGCGG - Intergenic
1077134744 11:992928-992950 GTGTGTGTGAGAGCATGCTGGGG + Intronic
1078063174 11:8061349-8061371 GTGTGTGGGGGCGTGTGCTGTGG + Intronic
1078188731 11:9074408-9074430 GTGTGTGTGTGCGCGTGCAAGGG + Intronic
1078594637 11:12675138-12675160 GTGTGTGCGCGTGCAGGCGGCGG - Intronic
1078823500 11:14905777-14905799 GTGTGTTCGGGCGCGCGTTGGGG + Intronic
1079798163 11:24833699-24833721 GTGTGTGTGCGCGCGCGCGGTGG - Intronic
1081528275 11:43942074-43942096 GTGCGCGCGCGCGCCTGCGGAGG + Intronic
1081804140 11:45881027-45881049 GTGTGTGTGCGCGTGTGCAGAGG + Exonic
1083712450 11:64557555-64557577 GTGTCTGCGCACAGGTGCTGAGG + Intronic
1084285103 11:68125903-68125925 GTGTGTGCGCGCGCGCGTTATGG - Intergenic
1085481095 11:76823661-76823683 CTGTGTGTGTGTGCGTGCTGGGG - Intergenic
1086380500 11:86247248-86247270 GTGTGTGCGTGCGCATGCCTTGG + Intronic
1088566747 11:111180604-111180626 GTGTGCGCGCACGCGTGTGGTGG - Intergenic
1088869027 11:113875652-113875674 TTGCGTGCGCGCGCATGCCGGGG - Intergenic
1089777599 11:120849152-120849174 GTGTGTGTGTGCGCGCGTTGGGG - Intronic
1091023852 11:132124617-132124639 GTGTGTGCGCGCGCACGCGCAGG + Intronic
1091107633 11:132937620-132937642 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1092046916 12:5437875-5437897 ATGTGCGTGCGTGCGTGCTGGGG + Intronic
1092255326 12:6923972-6923994 GTGTGTGCACGCGCATTTTGGGG + Intergenic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1094005005 12:25740046-25740068 GTGTGTGCGAGTGTGTGGTGAGG - Intergenic
1095692845 12:45110218-45110240 GTGTGTGCGCGCACGGGGGGTGG - Intergenic
1096242677 12:49967674-49967696 GTGTGTGCGCGCGTGTGCACGGG - Intronic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1096847903 12:54418206-54418228 GGGTGTGTGCGCGCGTGAAGGGG - Intronic
1097195520 12:57240558-57240580 GTGTGTGTGTGCGCGCGCCGGGG - Intronic
1098614830 12:72509265-72509287 GTGTGTGCGGGGGGGTGCGGTGG - Intronic
1098636252 12:72787434-72787456 GTGTGTGTGCACGTGTGCAGAGG + Intergenic
1098919180 12:76287244-76287266 GTGTGTGCGTGTGTGTGCAGAGG + Intergenic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1101966339 12:109284781-109284803 GTGTGTGTGCGCACATGCTGTGG + Intronic
1101966403 12:109285265-109285287 GTGTGTGTGTGCGCGCACTGCGG + Intronic
1102530843 12:113545517-113545539 GTGTGTGTGCACGCGTGCTCTGG + Intergenic
1103940983 12:124501035-124501057 GTGCGCGCGCGCTCGTGCCGTGG - Intronic
1103971734 12:124676888-124676910 GTGTGTGTGCGTGCGTGCGCGGG + Intergenic
1104916545 12:132268264-132268286 GTGTGTGCGTGCGTGTGTAGGGG - Intronic
1105323263 13:19347223-19347245 GTGTGTGCGCGCACTTGGTGGGG - Intergenic
1105438119 13:20394631-20394653 GTGTGTGTCCGCGCGCGCTCAGG - Intergenic
1105964300 13:25371444-25371466 GTGTGTGTGTGTGCGTGCGGGGG + Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1106019700 13:25902930-25902952 GTGTGTGTGTGTGCATGCTGAGG - Intronic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1107045047 13:35984882-35984904 GTGTGTGCATGCGCACGCTGGGG - Intronic
1107459236 13:40585330-40585352 GTGTGTGTGCGCGCGCGCAGAGG - Intronic
1108363707 13:49690487-49690509 GTGCGTGCGCGTGTGTGGTGGGG + Intronic
1108530891 13:51326038-51326060 GTGTGTGCGCGCGCGCACGTGGG + Intergenic
1110441218 13:75527996-75528018 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1110675714 13:78241169-78241191 GTGTGTGCGCGTGCATGTTTGGG - Intergenic
1111343437 13:86917682-86917704 GTGTGTGCGCGCGCACGTGGTGG - Intergenic
1112508764 13:99990827-99990849 GTGTGTGTGCGCGCGCGCAAAGG - Intergenic
1113653938 13:112056727-112056749 GTGTGCGCGCGCGCGAGGCGAGG + Intergenic
1113667444 13:112150765-112150787 GTGTGTGTGTGCGCTTGCTGTGG - Intergenic
1113667482 13:112150911-112150933 GTGTGTGTGTGCGCTTGCCGTGG - Intergenic
1113667505 13:112151011-112151033 GTGTGTGTGTGCGCTTGCCGTGG - Intergenic
1113667515 13:112151063-112151085 GTGTGTGTGTGCGCTTGCCGTGG - Intergenic
1113667518 13:112151088-112151110 GTGTGTGTGCGCGCTTGCCGTGG - Intergenic
1113667524 13:112151136-112151158 GTGTGTGTGTGCGCTTGCCGTGG - Intergenic
1114492258 14:23110564-23110586 GTGGGTTCAAGCGCGTGCTGAGG - Intergenic
1114612752 14:24053045-24053067 GTGTGCACGCGCGTGTGCTGGGG - Intronic
1114612754 14:24053047-24053069 GTGTGTGCACGCGCGTGTGCTGG - Intronic
1118181037 14:63493488-63493510 GTGTGTGCGTGTGTGTGGTGGGG + Intronic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1120497409 14:85254067-85254089 GTGTGTGTGCGCGCGTTGTGGGG - Intergenic
1120497411 14:85254069-85254091 GTGTGTGTGTGCGCGCGTTGTGG - Intergenic
1120850014 14:89161589-89161611 GTGTGTGTGCGTGCGTGCACAGG + Exonic
1121270806 14:92636927-92636949 GTGTGTGTGCGTGTGTGCTTGGG + Intronic
1122183425 14:99971766-99971788 GTGTGCGCGGGCGCGTGCCTGGG - Intronic
1122368333 14:101212351-101212373 GTGTGTGTGCGTGTGTGTTGAGG - Intergenic
1122418330 14:101560826-101560848 GTGTGAGCGCGCGCGGGAGGCGG + Intergenic
1122630449 14:103105148-103105170 GGGAGTGCGCGCGCGTGGAGGGG + Intronic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG + Intronic
1125476394 15:40050744-40050766 GTGTGTGTGCGCGTGTGAGGGGG + Intergenic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1125917604 15:43503153-43503175 GTGTGTGTGCGCGCATGCGCGGG + Intronic
1126348119 15:47717785-47717807 GTGTGTGTGTGCGCGCGGTGGGG + Intronic
1126419531 15:48456866-48456888 GTGTGTGCGTGCATGTGTTGGGG + Intronic
1126676072 15:51160228-51160250 GTGTCTGAGAGCGAGTGCTGGGG - Intergenic
1128582788 15:68820623-68820645 GTGTGTGTGTGTGCGCGCTGGGG - Intronic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129606447 15:77027563-77027585 CTGTGTGCGCACGTGTGTTGGGG + Intronic
1129741243 15:77990656-77990678 GTGTGTGCGCGCGCATGTTGGGG - Intronic
1130369204 15:83269439-83269461 GTGTGTGCGCGCGCATCTGGAGG + Intronic
1130371062 15:83285242-83285264 GTGTGTGTGTGCGTGTGCGGTGG - Intergenic
1131713750 15:95085567-95085589 GTGTGTGTGTGCGCGTGCGCAGG + Intergenic
1132114162 15:99123740-99123762 GTCTGTGCGGGAGCCTGCTGGGG - Intronic
1132460905 16:54059-54081 GTGTGTGCGGGCGGGGGCTGGGG + Intronic
1132505933 16:308726-308748 GTGTGTGCGTGCTTGTGCTGTGG - Intronic
1132692183 16:1186561-1186583 GTGTGTGGGCACGTGTGCAGAGG - Intronic
1133924259 16:10181170-10181192 GTGTGCACGCGCGCGTGTAGGGG - Intronic
1134070690 16:11257690-11257712 GTGCGTGCGCGTGCGTGAGGGGG + Intronic
1134203653 16:12219905-12219927 GTGTGTGCGCTGGGGGGCTGTGG - Intronic
1134518819 16:14908494-14908516 GTGTGTGTGTGTGTGTGCTGAGG + Intronic
1134706490 16:16307149-16307171 GTGTGTGTGTGTGTGTGCTGAGG + Intergenic
1134961050 16:18404975-18404997 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
1134965352 16:18487578-18487600 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1135037738 16:19092171-19092193 GTGTGTGTGCGCGCGCGCATTGG + Intergenic
1135656685 16:24256282-24256304 GTGTGCGAGCGCGTGTGCTGGGG - Exonic
1135656687 16:24256284-24256306 GTGTGTGCGAGCGCGTGTGCTGG - Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1136855779 16:33656036-33656058 GTGTGTGCGCGCGCATAGCGGGG - Intergenic
1137365224 16:47854083-47854105 GTGTGTGCGTTTGTGTGCTGGGG - Intergenic
1137365478 16:47855895-47855917 GTGTGTGTGCGCGTGTTCAGAGG + Intergenic
1138940078 16:61779457-61779479 GTGTGTGTGCGCGCATGGTGAGG + Intronic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1141826276 16:86482599-86482621 GTGTCTGTGTGCGCGTGGTGGGG + Intergenic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983429 16:87563992-87564014 GTGTGTGTGCGCGTGTGTTGGGG + Intergenic
1141983453 16:87564284-87564306 GTGTGTGCGCATGGGTGTTGGGG + Intergenic
1141983456 16:87564334-87564356 GTGTGTGTGCGTGTGTGTTGGGG + Intergenic
1142351330 16:89582069-89582091 GTGTGTGAGCACGTGTGCTGTGG + Intronic
1142410585 16:89913953-89913975 GTGTGTGTGCGCATGTGGTGTGG + Intronic
1203117364 16_KI270728v1_random:1504517-1504539 GTGTGTGCGCGCGCATAGCGGGG - Intergenic
1142591562 17:1008436-1008458 CCGTGTGCGCGCGTGTGGTGAGG - Intronic
1142715628 17:1745464-1745486 GGGGGTGGGGGCGCGTGCTGAGG + Intronic
1142810220 17:2392683-2392705 GCGTGGGTGCGCGCGTGCTTCGG - Intronic
1143102603 17:4512638-4512660 GTGTGTGCGTGCGCGCGCACGGG + Intronic
1144172835 17:12676230-12676252 GTGTGTGCGTGCGCGCGCAGGGG - Intronic
1144684385 17:17216357-17216379 GTGCGTGCCCCCGCGGGCTGTGG - Intronic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1147139487 17:38453453-38453475 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1147864956 17:43545977-43545999 GTGTACGCGCGCGCGCGCGGAGG + Intronic
1148563406 17:48619262-48619284 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
1148769102 17:50056682-50056704 GAGTGTGCGAGCGCGGGATGCGG + Intronic
1148859214 17:50595376-50595398 GTGTGTGCGTGCCTGTGCTGAGG + Intronic
1149548022 17:57518756-57518778 GTGCGTGCGTGCATGTGCTGGGG - Intronic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1150429861 17:65106430-65106452 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1151509830 17:74551437-74551459 GTGTGTGCGCACGCATGCACAGG - Intergenic
1151914579 17:77108090-77108112 GTGTGTGCGTGCGCATGGTATGG - Intronic
1152148683 17:78585156-78585178 GTGTGTGTGTGCGCGTGCATAGG - Intergenic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1153660776 18:7324288-7324310 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1153923166 18:9809050-9809072 GTGTGTGCGCGCGCACGCGTGGG + Intronic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1156000353 18:32378052-32378074 GTGTGTGCGCGCGGGCGCTTTGG + Intronic
1156099776 18:33578854-33578876 GTGTGTGCGTGCGCGCGCGGAGG + Intronic
1157032974 18:43935846-43935868 GTGTGTGTGTGTGCGTGCAGTGG + Intergenic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1157625378 18:49046288-49046310 GTGTGTGCGCGCGCATGTCTGGG - Intronic
1158400924 18:57121187-57121209 GTGTGTGCACGCGAGTGCGCAGG + Intergenic
1158427474 18:57352713-57352735 GTGAGCGCGCGCGCGTGTGGCGG - Exonic
1159014717 18:63091833-63091855 GTGTGTGTGAGAGCGTGGTGTGG + Intergenic
1159963649 18:74575739-74575761 GTGTGTGCGCGTGTGTGAAGGGG + Intronic
1160357892 18:78244193-78244215 GTGTGTGCGCGTGTGTGAAGTGG - Intergenic
1160429132 18:78799603-78799625 GTGCGCGCGCGCGTGTGCAGTGG - Intergenic
1160968055 19:1755203-1755225 GTGTGAGCGCGCGCCTGTTGGGG + Intronic
1161264778 19:3359276-3359298 GTGTGTGTGCGCGCGCGCCGCGG + Intergenic
1161725470 19:5925871-5925893 GTGTGCGCGTGCATGTGCTGGGG + Intronic
1162129534 19:8517566-8517588 GTGTGTGTGCGTGTGTGCAGGGG + Intergenic
1162393827 19:10404892-10404914 GTCCGTGCGCGCGCGTGCCCGGG - Intronic
1163167594 19:15508582-15508604 GGGTGAGTGCGCGCGTGGTGAGG + Exonic
1163223478 19:15938216-15938238 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
1164840958 19:31391684-31391706 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1165531903 19:36409978-36410000 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
1166126019 19:40715863-40715885 GTGTGTGTGCGCGCGCGCGTTGG + Intronic
1166302195 19:41917637-41917659 GTGCGTGCGTGCGTGTGCTTTGG - Intronic
1166780787 19:45341575-45341597 GTGTGCGCGCGCGCGTGTGGTGG + Intronic
1167037256 19:47001762-47001784 GTGTGTGTGGGCGCTTGGTGGGG + Exonic
1168309369 19:55452770-55452792 GGGCGTGCGCGCGCCGGCTGGGG + Intergenic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
925556193 2:5133686-5133708 GTGTGTGTGTGTGCATGCTGTGG - Intergenic
925801629 2:7607768-7607790 GTGTGTGTGCACGCGTGCACAGG + Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926435795 2:12836256-12836278 GTGTGTGCGCACACGCGCTGAGG + Intergenic
926906129 2:17807377-17807399 GTGTGTGCTCGTGTGTGTTGGGG - Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927235518 2:20870908-20870930 GTGTGTGCGCGCGCGCATTCAGG + Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927926781 2:27019180-27019202 GTGTGTGAGAGCGGGTGCGGTGG - Intronic
929313280 2:40450364-40450386 GTGTGTGCACGCGCGCGCGCTGG + Intronic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
932329448 2:70889362-70889384 GGGGGTGCGAGCGCGGGCTGGGG - Intergenic
932588816 2:73050381-73050403 GTGTGTGTGTGCGTGCGCTGTGG - Intronic
933817235 2:86077796-86077818 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
935066026 2:99648870-99648892 GTGTGTGCGCGCGTGTTTTGAGG - Intronic
935408573 2:102735829-102735851 GTGTGCGCGCGCGCGTGTCCTGG - Intronic
937147293 2:119658610-119658632 GTGTGTGTGTGTGCGTGTTGAGG - Intronic
937851718 2:126642181-126642203 GTGTGTGTGCGTGCGGGGTGCGG - Intergenic
937950856 2:127387383-127387405 GTGTGTGCGCGCGTGTGTGTCGG - Intronic
938461892 2:131502709-131502731 GTGTGCGCGTGCGCGTGCAATGG - Intergenic
938682500 2:133705679-133705701 GTGTGGGCTCGTGAGTGCTGAGG + Intergenic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
941580808 2:167293576-167293598 GTGTGTGCGCGCGCGCGGCTTGG + Intergenic
941580810 2:167293578-167293600 GTGTGCGCGCGCGCGGCTTGGGG + Intergenic
941876237 2:170436354-170436376 GTGTGTGTGCGCATCTGCTGAGG + Intronic
942061499 2:172232243-172232265 GTGTGTGTGTGTGCATGCTGGGG + Intergenic
944494906 2:200296895-200296917 GTGCGTGCGCGCGCATTCAGGGG - Intergenic
944739925 2:202601889-202601911 GTCTGTGCGTGTGTGTGCTGGGG - Intergenic
945033357 2:205684937-205684959 GTGTGCGCGCTCGCGCGCTGGGG - Intronic
945033359 2:205684939-205684961 GTGTGTGCGCGCTCGCGCGCTGG - Intronic
947110617 2:226715454-226715476 GTGTGTGTGTGCGTGTGGTGGGG + Intergenic
947110650 2:226715694-226715716 GTGTGTGTGTGCGTGTGGTGGGG + Intergenic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
948661564 2:239510096-239510118 GTGTGTGTGCGTGTGTGCAGTGG + Intergenic
948772253 2:240257623-240257645 GTGTGTGTGCACGCGTGTGGAGG - Intergenic
1169832240 20:9838174-9838196 GTGTGTGCGCGCGCGCCTGGTGG - Intronic
1170960255 20:21019491-21019513 GTGTGTGCGCGCGCGCGGCAGGG - Intergenic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1171175012 20:23045205-23045227 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1172118300 20:32584118-32584140 GTGTGTGCGCGCGCGGAGGGTGG - Intronic
1172118302 20:32584122-32584144 GTGTGTGTGTGCGCGCGCGGAGG - Intronic
1173429589 20:42974458-42974480 GTGTGTGCGCGCGTGCACTGAGG - Intronic
1174887018 20:54347078-54347100 GTGTGTGCATGTGCGTGCTTTGG + Intergenic
1175073370 20:56353483-56353505 ATGTGTGCGGGCACCTGCTGAGG - Intergenic
1175593320 20:60211153-60211175 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1177860830 21:26451862-26451884 GTGTGTGTGTGTGCGTGCAGTGG - Intergenic
1177999955 21:28149954-28149976 GTGTGTGTGTGTGCGTGCTCAGG + Intergenic
1179228214 21:39474897-39474919 GTGTGTGTGTGCTCTTGCTGTGG + Intronic
1179569250 21:42268381-42268403 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1179884581 21:44308137-44308159 GTGGGTGGGCGCGGGTCCTGGGG + Intronic
1179950827 21:44707992-44708014 GTGTGTGCACGCGCGGGGCGGGG - Intronic
1180246072 21:46548210-46548232 TTGTGTGCGCCTGCGTGCAGGGG + Intronic
1181069257 22:20322341-20322363 GTGTGTGCGCGCGCGCACAATGG - Intergenic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1182041635 22:27242811-27242833 GTGTGTGCGCGCGTGCGCGGGGG - Intergenic
1182041637 22:27242813-27242835 GTGTGTGTGCGCGCGTGCGCGGG - Intergenic
1182149510 22:28018293-28018315 GTGTGTGCGCGCGCGGGGGGGGG + Intronic
1182667253 22:31968804-31968826 GTGTGTGTGCGTGTGTGTTGGGG - Intergenic
1183034868 22:35134019-35134041 GTGTGTGTGCGCGTGTGCGCAGG + Intergenic
1183426732 22:37743873-37743895 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1183664998 22:39242096-39242118 GTGTGCGCGCACGTGTGCTCAGG + Intronic
1183683639 22:39349804-39349826 GCGCGGGGGCGCGCGTGCTGCGG - Intergenic
1184128940 22:42505719-42505741 GTGTGCGCGTGCGTGTGGTGGGG - Intergenic
1184128942 22:42505721-42505743 GTGTGTGCGCGTGCGTGTGGTGG - Intergenic
1184137735 22:42559034-42559056 GTGTGCGCGTGCGTGTGGTGGGG - Intronic
1184137737 22:42559036-42559058 GTGTGTGCGCGTGCGTGTGGTGG - Intronic
1184265676 22:43344493-43344515 GTGTGTGCGTGTGTGTGTTGGGG - Intergenic
1184400210 22:44269463-44269485 GTGTGTGTGTGCGCGTGTTGTGG - Intronic
1184478209 22:44732658-44732680 GTATGTGCGTGTGCGTGCTGGGG - Intronic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
949255000 3:2035543-2035565 GTGTGTGCACACATGTGCTGAGG - Intergenic
949528324 3:4928391-4928413 GTGTGTGTGCGTGTGTGTTGTGG + Intergenic
950316144 3:12003974-12003996 GCGTGTGTGCGCGCGTGATTGGG + Intergenic
952316865 3:32238982-32239004 GTGTGCGAGCGGGCGCGCTGCGG - Exonic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
954256661 3:49412060-49412082 GTGAGTGCGCGCGCGTGCGCGGG - Exonic
954505455 3:51067451-51067473 GTGTGTGCGCGCGCGTTGGAGGG + Intronic
954679962 3:52339824-52339846 GTGTGTGTACACACGTGCTGGGG + Intronic
955456781 3:59130293-59130315 GTGTGTGCGCGCTTGTGTTCAGG + Intergenic
955663260 3:61323981-61324003 GTGTGTGTGTGCGCGCGTTGGGG + Intergenic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
958166143 3:89880290-89880312 GTGTGTGTGTGCGTGTGCTGTGG + Intergenic
959515236 3:107258690-107258712 GTGTGTGCTTGTGCGTGCTTTGG - Intergenic
960047441 3:113211695-113211717 GTGTCTGTGCGCGCGCGCGGCGG - Exonic
960281247 3:115783980-115784002 CCGTGTGCGCGCGCGTGTCGGGG + Intergenic
960702258 3:120450600-120450622 GCGGGTGGGCGCGCGTCCTGGGG - Intronic
960790230 3:121422089-121422111 GTGTGTGTGCGTGCGTGCTAAGG - Exonic
961356967 3:126345462-126345484 GTGTGTGTGCGTGCATGCTTTGG - Intronic
963922699 3:150921388-150921410 GTGTGTGCGTGCACATGCAGGGG - Intronic
965824423 3:172716576-172716598 GTGTCCGCGCCCGCGTGATGGGG + Intergenic
966161277 3:176971299-176971321 GTGTGTGCATGCACGTGCTTCGG + Intergenic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
966711655 3:182979359-182979381 GTGTGTGCGCGCCTGTGTTAAGG - Intronic
967858504 3:194135024-194135046 GTGTGTGTGCGCGCGCCCCGGGG - Intergenic
967987458 3:195106412-195106434 GTGTGTGCGGGGCCGTGCTGGGG - Intronic
968063761 3:195746902-195746924 GTGTGCACGCGCGCGTGCACAGG + Exonic
968564768 4:1305719-1305741 GTGTGTGCGCACGCGTGTGTGGG + Intronic
968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG + Intergenic
969533819 4:7743791-7743813 GTGTGTGCGCGCGCGCGTGAGGG - Intergenic
970826545 4:20283105-20283127 GTGTGTGCGCGCGCGCACACAGG - Intronic
971809569 4:31406810-31406832 GTGTGTGTCCGCGCGCGTTGGGG - Intergenic
973635876 4:52861959-52861981 GCGAGTGCGCGCGTGGGCTGTGG + Intergenic
975485860 4:74933580-74933602 GTTTGTGCGGGCGCGGGCTGCGG - Intronic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
978384967 4:108169151-108169173 GTGTGTGCGCGCGCGCCTGGAGG + Intergenic
980013735 4:127623901-127623923 GCGCATGCGCGCGCGTGTTGGGG - Intronic
980282694 4:130740793-130740815 GTGTGTGTGCACACTTGCTGTGG + Intergenic
981034458 4:140154504-140154526 GTATGCGCGCGCGCGTGCGCGGG + Intergenic
983577002 4:169270994-169271016 GTGTGTGTGCGCGCGTGAGGGGG - Exonic
983672166 4:170250617-170250639 GTGTGTGCGCGTGCGAGCTGTGG + Intergenic
985565851 5:616824-616846 GTGTGTGTGCGCGCGAGTGGGGG + Intronic
985671997 5:1211410-1211432 GTGTTTGCGCTCCCGGGCTGGGG - Intronic
985751975 5:1685866-1685888 GTGCATGTGCGCGTGTGCTGAGG + Intergenic
985895918 5:2750077-2750099 CTGTGTGCGCGCACGTGCAAGGG - Intronic
985963944 5:3325250-3325272 GTGTGAGCGCGCGCGTGCGTGGG + Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
987175437 5:15303434-15303456 GTGCGCGCGTGCGTGTGCTGAGG + Intergenic
987901085 5:24013042-24013064 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
989033991 5:37150507-37150529 GTGTGCGCGCGTGTGTGTTGGGG - Intronic
989033993 5:37150509-37150531 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
989131353 5:38110260-38110282 GTGTGTGCGTGTGTGTGTTGAGG - Intergenic
992260285 5:74963326-74963348 TTGTGTGTGCGCGCATGCTTTGG - Intergenic
994314807 5:98320480-98320502 GTGTGTGTGTGCGTGTGGTGTGG - Intergenic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
995250157 5:109983944-109983966 GTGTGTGCGCACGCGCACAGTGG - Intergenic
996537009 5:124587993-124588015 GTGTGTGTGTGTGCATGCTGGGG - Intergenic
997031012 5:130128248-130128270 GTGTGTGCGCTCACATGCTCAGG + Intronic
997459874 5:134044655-134044677 GTGTGTGTGCGCGCGCGCACAGG + Intergenic
997899844 5:137754365-137754387 GAGGGTGCGCGCGCGTTCAGCGG - Exonic
998143248 5:139711409-139711431 GTGTGTGCGCGCGCGCTCCGAGG + Intergenic
999243657 5:150141766-150141788 GTGTACACGCGCACGTGCTGAGG + Intronic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1000665423 5:163989215-163989237 GTGTGCGCGCGCGTGTGGGGGGG + Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001245729 5:170104852-170104874 GTGTGTGCGCGTGCGTGCGTGGG + Intergenic
1002058834 5:176614168-176614190 GTGTGTGTGCGCGCGCGCAGGGG - Intergenic
1002254995 5:177952049-177952071 GTCTGTGCGTGTGTGTGCTGGGG + Intergenic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002559739 5:180072914-180072936 GTGTGCGCGCGCGCGCGTTTCGG - Intergenic
1002956565 6:1871053-1871075 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1003030766 6:2598748-2598770 GTGTGTGTGTGCGCGCGCTGGGG + Intergenic
1003035487 6:2637533-2637555 GTGTGTGTGTGCGCGTGCGGGGG + Intergenic
1003427530 6:6007555-6007577 GTGTGTGTGTGCTCGTGCGGGGG - Intronic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1004351960 6:14898005-14898027 GTGTGTGCGCGTGTGTGTGGTGG - Intergenic
1004849214 6:19679527-19679549 GTGTGTGCGCGCGCATGTGGTGG + Intergenic
1005672740 6:28123646-28123668 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1006137242 6:31902397-31902419 ACGGGTGCGCGCGCGCGCTGCGG - Intronic
1006458322 6:34144347-34144369 GTGTACGCGCGTGTGTGCTGGGG - Intronic
1007410036 6:41656181-41656203 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1007600574 6:43078255-43078277 GTGTGTGCGCGCGTGTGTGTGGG + Intronic
1008009302 6:46446298-46446320 GTGTGTGGGTGGGGGTGCTGGGG + Intronic
1008598338 6:53065296-53065318 CTGTGTGCGCGCGCCTGACGCGG - Intronic
1010088858 6:71954841-71954863 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1012515945 6:100059382-100059404 GTGCGTGCGCGCACGCACTGAGG + Intergenic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1013732655 6:113186499-113186521 GTGTGCGCGCGCATTTGCTGTGG - Intergenic
1014109283 6:117602370-117602392 GAGTGTGCCCGCGCGCGCGGGGG - Intronic
1014632353 6:123803243-123803265 GTGTGTGCGCGCGCGCTCGGGGG - Intergenic
1014632355 6:123803245-123803267 GTGTGTGTGCGCGCGCGCTCGGG - Intergenic
1015440761 6:133242877-133242899 GTGTGTGCGGGAGAGTGGTGTGG + Intronic
1015483611 6:133743382-133743404 GTGTGTGTGTGTGCGTACTGAGG - Intergenic
1016308015 6:142703481-142703503 GTGCGTGCGCGCGCATGTTGCGG - Intergenic
1017164516 6:151394778-151394800 GTGTGTGTGTGCGCGCGCTTAGG + Intergenic
1017175081 6:151494720-151494742 GTGTGTGTGCGCGCGCGCATTGG - Intronic
1017406956 6:154129847-154129869 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1017439604 6:154451460-154451482 GTGTGTGTGCGCGTTTGGTGGGG - Intronic
1017447391 6:154519261-154519283 ATGTGTGTGCGCGCGTGCGCAGG - Intergenic
1017543505 6:155427013-155427035 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1017811919 6:157989846-157989868 GTGTCTGCGGGAGGGTGCTGGGG + Intronic
1017973983 6:159338224-159338246 GTGTGTGCAGGCACCTGCTGTGG - Intergenic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018937281 6:168281988-168282010 GTGTGGGCCAGCGAGTGCTGTGG + Intergenic
1019581672 7:1766998-1767020 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021107627 7:16656542-16656564 GTGTGTGTGCGCGCGCGCGCTGG - Intronic
1023319419 7:38976616-38976638 GTGTGTGTGCGCGCGCGCTTCGG + Intergenic
1026665604 7:72337393-72337415 GTGTGAGTGCGCGCGCGCCGAGG - Intronic
1029449595 7:100633393-100633415 GTGAGTGCGCGCGCGGGCGGGGG - Intronic
1031011291 7:116526793-116526815 GTGTGTGTGTGCGCGTGTAGGGG - Intronic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032013413 7:128360972-128360994 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
1032189512 7:129756096-129756118 GTGTGTGTGCGTGCATGGTGGGG + Exonic
1032496296 7:132365359-132365381 GTGCGTGCGCGCGCATGCATGGG + Intronic
1032532585 7:132634457-132634479 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1032651603 7:133884615-133884637 GTGTGTGCGCGCGTGTGTGATGG + Intronic
1032792372 7:135252038-135252060 GTGTGTGTGCACCCCTGCTGGGG + Intronic
1033657905 7:143385632-143385654 GTGTGTGTGAGCGTGTGGTGTGG + Intronic
1033927025 7:146474982-146475004 GCGCGTGCGCGCTCGTGCTCAGG - Intronic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1035217741 7:157381772-157381794 GTGTGGGCGCGCGCATGTTAGGG + Intronic
1035368855 7:158365886-158365908 GTGTGTGTGCACGCGTGCATTGG - Intronic
1035368874 7:158366058-158366080 GTGTGTGTGCACGCGTGCATTGG - Intronic
1035979062 8:4348591-4348613 GTGTGTGCGTGGGTGTGTTGGGG + Intronic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1039200561 8:35088367-35088389 GTGTGTGTGTGTGCATGCTGAGG - Intergenic
1041990543 8:63985001-63985023 GTGTGTGTGCGTGTGTGTTGAGG + Intergenic
1044488667 8:92785610-92785632 GTGTGTGTGCGCGCGTGCATAGG - Intergenic
1044707779 8:95025091-95025113 GTCTGTACGCGCGCATGCGGCGG + Exonic
1045287780 8:100806878-100806900 GTGTGTGCGCGCGCACGCACAGG + Intergenic
1045538648 8:103059869-103059891 GTGTGTGTGTGTGCGTGCTGGGG - Intronic
1045844864 8:106622448-106622470 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1046094345 8:109539853-109539875 TTGTGTGCGCGCGCGGCCCGCGG + Intronic
1046209406 8:111048004-111048026 GTGTGTGTGCGTGCGCACTGGGG + Intergenic
1047423565 8:124727079-124727101 GTGTGCGCGCGCGCGCGTGGGGG - Intronic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1047591742 8:126334428-126334450 GTGTGTGTGTGTGTGTGCTGTGG - Intergenic
1047969533 8:130072817-130072839 GTGTGTGTGCGCGCGGGGGGGGG + Intronic
1048244050 8:132774815-132774837 ATGTGTGTACGCGCGTGCTCAGG - Intergenic
1048454819 8:134568046-134568068 GTGTGTGCACTCATGTGCTGGGG - Intronic
1048484255 8:134832340-134832362 GTGTGTGTGCGCGCGCGCGTGGG + Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1049032347 8:140047220-140047242 GTGCGTGCGCGTGTGTGATGTGG - Intronic
1049342872 8:142123053-142123075 GTGTGTGCGCACATGGGCTGTGG - Intergenic
1049452367 8:142669194-142669216 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050091283 9:2017556-2017578 GTGTGTGCGCGCGCGAGCGGCGG + Intronic
1050669938 9:7984573-7984595 GTGTGTGCGAGGGGGTGGTGGGG + Intergenic
1050771851 9:9211500-9211522 GTGTGTGCGTGCGCACACTGGGG - Intronic
1052051153 9:23850826-23850848 GTGTGTGCGCGCGAGTGACAGGG - Intergenic
1054785600 9:69207113-69207135 GTGTGTACGCACGCATGCAGTGG - Intronic
1059269328 9:113062085-113062107 GTGTGCGCGCCCGCGTGCTTGGG + Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1060051756 9:120383151-120383173 GTGTGTGCGCGCCCTGGCGGCGG - Intergenic
1060463867 9:123884982-123885004 GTGTGTGCGCGCGCGCTCGCAGG - Intronic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1062022457 9:134326051-134326073 GTGTGTGCGCGAGTGTGTGGCGG + Intronic
1062119923 9:134828983-134829005 GTGTGTGCGCGTGCATGGTGTGG - Intronic
1062325560 9:136010925-136010947 GTGTGTGCGTGTGTGTGCAGGGG - Exonic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1185723143 X:2397919-2397941 GTGTGTGTGTGCGCGCTCTGAGG - Intronic
1186209982 X:7240450-7240472 GTGTGTGCGCGCGCGCTCCTTGG - Intronic
1186490594 X:9969422-9969444 GTGTGTGCGCGCGTGCACTGGGG - Intergenic
1186490596 X:9969424-9969446 GTGTGTGTGCGCGCGTGCACTGG - Intergenic
1187855982 X:23636691-23636713 GTGTGTGTGCCAGAGTGCTGGGG - Intergenic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1188597812 X:31922522-31922544 GTGTGCGCGCGCGTGCGCTAGGG + Intronic
1189241709 X:39529675-39529697 GTGTGTGCGTGTGTGTGGTGGGG - Intergenic
1192148312 X:68696334-68696356 GTGTGTGCGCACGTGTGCATGGG + Intronic
1194035534 X:88866236-88866258 GTGTGTGTGCGCGCGCGCAAAGG + Intergenic
1194035536 X:88866238-88866260 GTGTGTGCGCGCGCGCAAAGGGG + Intergenic
1195668472 X:107450311-107450333 TTGTGTGCGCGCCTGGGCTGTGG + Intergenic
1195922580 X:109998333-109998355 GTGTGTGCGTGCACGTGCTTGGG + Intergenic
1197655139 X:129108644-129108666 GTGTGTGTGCGCGCGCGCGGCGG + Intergenic
1197655141 X:129108646-129108668 GTGTGTGCGCGCGCGCGGCGGGG + Intergenic
1197782488 X:130171888-130171910 GTGCGCGCGCGCGCGTGAAGGGG - Exonic
1198115493 X:133540946-133540968 GTGTGTGTGTGCGCGCACTGTGG + Intronic
1199506164 X:148563493-148563515 GTGTGTGTGTGTGCATGCTGGGG + Intronic
1200092674 X:153643220-153643242 GCAGGTGTGCGCGCGTGCTGGGG - Intronic
1200338075 X:155373462-155373484 GTGTGCACGCGCACGTGCTTAGG - Intergenic
1200348394 X:155467232-155467254 GTGTGCACGCGCACGTGCTTAGG + Intergenic