ID: 1157263890

View in Genome Browser
Species Human (GRCh38)
Location 18:46200086-46200108
Sequence GTGTGTGCGCGCGCGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157263887_1157263890 16 Left 1157263887 18:46200047-46200069 CCTTACAGAAAATTCTTTATTGT No data
Right 1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157263890 Original CRISPR GTGTGTGCGCGCGCGTGCTG GGG Intronic