ID: 1157263964

View in Genome Browser
Species Human (GRCh38)
Location 18:46200637-46200659
Sequence CAGGTAGGGCAGCTGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3626
Summary {0: 1, 1: 0, 2: 2, 3: 154, 4: 3469}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157263955_1157263964 15 Left 1157263955 18:46200599-46200621 CCTGGCCAGGATGGGGTTTTTAT 0: 1
1: 0
2: 5
3: 65
4: 583
Right 1157263964 18:46200637-46200659 CAGGTAGGGCAGCTGAAGTCTGG 0: 1
1: 0
2: 2
3: 154
4: 3469
1157263951_1157263964 23 Left 1157263951 18:46200591-46200613 CCACCGCACCTGGCCAGGATGGG 0: 1
1: 10
2: 68
3: 613
4: 3182
Right 1157263964 18:46200637-46200659 CAGGTAGGGCAGCTGAAGTCTGG 0: 1
1: 0
2: 2
3: 154
4: 3469
1157263954_1157263964 20 Left 1157263954 18:46200594-46200616 CCGCACCTGGCCAGGATGGGGTT 0: 1
1: 0
2: 13
3: 137
4: 751
Right 1157263964 18:46200637-46200659 CAGGTAGGGCAGCTGAAGTCTGG 0: 1
1: 0
2: 2
3: 154
4: 3469
1157263957_1157263964 10 Left 1157263957 18:46200604-46200626 CCAGGATGGGGTTTTTATGGTTG 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1157263964 18:46200637-46200659 CAGGTAGGGCAGCTGAAGTCTGG 0: 1
1: 0
2: 2
3: 154
4: 3469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157263964 Original CRISPR CAGGTAGGGCAGCTGAAGTC TGG Intronic
Too many off-targets to display for this crispr