ID: 1157269890

View in Genome Browser
Species Human (GRCh38)
Location 18:46265258-46265280
Sequence GGCCTCTGCCCTGACAGTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157269890 Original CRISPR GGCCTCTGCCCTGACAGTGG GGG (reversed) Exonic
900125326 1:1066661-1066683 GGCCTCCGCCCTCACAGGGAAGG - Intergenic
900298705 1:1965801-1965823 GGCTTTTGCCCTGACAGTAGAGG + Intronic
900434866 1:2625056-2625078 GGCCTCTCCCCTGACACATGAGG + Intronic
901797865 1:11691224-11691246 GGCCCCTGCCCTGACAGACGCGG + Intronic
901842203 1:11960785-11960807 GTACTCTCCACTGACAGTGGGGG + Intronic
901915010 1:12492153-12492175 GGCCGCAGGCCTAACAGTGGTGG + Intronic
902819426 1:18934861-18934883 GGACTCTGCGCTGACAGTGGAGG - Intronic
902847370 1:19122578-19122600 GGCCACTCACCTCACAGTGGAGG + Intronic
903895830 1:26603515-26603537 GACTTCTGTCCTGAGAGTGGAGG + Intergenic
905318072 1:37096231-37096253 GGCCTCTGCCCTGTGACTGATGG - Intergenic
908656415 1:66393801-66393823 GGGCTAGGCCCTGACAGAGGAGG + Intergenic
910497727 1:87851659-87851681 GAGCTCTGACCTGACAGTGGGGG - Intergenic
910952653 1:92667198-92667220 GGCCTCAGCCCTGGAAGTGGAGG + Intronic
911563664 1:99436292-99436314 AGCCTCTGCCCTGGAAGTAGTGG - Intergenic
912855951 1:113168966-113168988 GGCCTCTGCGCTGCCAGCCGGGG - Intergenic
915438068 1:155924455-155924477 CGCCTCGGCCCTGAAAGTGCTGG + Intronic
915543234 1:156581937-156581959 GGCCGCAGCCCTGGCACTGGGGG + Exonic
915571758 1:156748776-156748798 GGCCTCAGCCCTGGGTGTGGTGG - Intronic
916766047 1:167861791-167861813 GGTCTCTCCCCTGACACTCGGGG - Intronic
919189223 1:194194569-194194591 GGTCCCTGCCCTGACAGGTGGGG - Intergenic
919703915 1:200658156-200658178 GGCCTCTGCTCTGTCACTGCTGG + Intronic
921172492 1:212561658-212561680 AGCCTGGGCCCTGACAGAGGTGG + Intergenic
921847574 1:219900319-219900341 GGCCTATCTCCTGACATTGGGGG + Intronic
922256503 1:223897185-223897207 GCCCTCAGCCCTGAGAGTGAGGG - Intergenic
923147898 1:231210492-231210514 TGCCTCTGCCCGGACACTGCAGG + Intronic
924193172 1:241577811-241577833 GGCCCCAGCCTTGACAGAGGTGG + Intronic
924337712 1:243000044-243000066 GCCCTCAGCCCTGAGAGTGAGGG - Intergenic
924659285 1:246002011-246002033 GGACTCTGCAATTACAGTGGTGG - Intronic
924695531 1:246395831-246395853 CTCCTCTCCCCTGACAGTGGTGG - Intronic
1063133799 10:3199481-3199503 CTCACCTGCCCTGACAGTGGAGG - Intergenic
1063232993 10:4084569-4084591 GTCTTCTGCTCTCACAGTGGAGG - Intergenic
1063655382 10:7983115-7983137 GGCCTCTGCGGTGGCAGAGGTGG + Intronic
1066681347 10:37939015-37939037 GGCCACTGCCCTGCCAGTCCAGG + Intergenic
1067225436 10:44373229-44373251 GGGCCCTGCCCTGGCAGGGGAGG + Intronic
1067751296 10:48973521-48973543 TGTCTCTGCCCTGAGGGTGGAGG + Intronic
1069595106 10:69665230-69665252 GGTCTGAGCCCTGACACTGGAGG - Intergenic
1069814682 10:71186368-71186390 GCCATCAGTCCTGACAGTGGGGG + Intergenic
1069953586 10:72036076-72036098 AGTCTCTGCCCTGAAAGAGGAGG - Intergenic
1071674253 10:87639794-87639816 GGCCTCCCCACTCACAGTGGTGG - Intergenic
1071692788 10:87839946-87839968 GGCTTTAGCCCTGCCAGTGGTGG + Intronic
1073023874 10:100471420-100471442 GGCCTGTGCCCTGGCAGATGTGG + Intronic
1075074413 10:119341297-119341319 GGACTCTGTCCTGACAGCAGTGG - Intronic
1075654197 10:124150708-124150730 GGCCTTTGTCCTGACAGGGCTGG + Intergenic
1076437365 10:130455258-130455280 GGCCTCTCTCCAGAAAGTGGAGG - Intergenic
1076524744 10:131105262-131105284 TGACTCTTCACTGACAGTGGTGG + Intronic
1076589935 10:131576031-131576053 TCCCTCTGCCCTGGCAGGGGTGG - Intergenic
1076800185 10:132818172-132818194 TGCCCCTGCCATGACAGTGGTGG + Intronic
1076910975 10:133389377-133389399 GGCCTCTGACCCGACAGCAGCGG - Intronic
1077405040 11:2379028-2379050 CGGCACTGCCCTGGCAGTGGGGG + Intronic
1077615341 11:3670004-3670026 GGCCCCAGCCCTGGGAGTGGAGG - Intronic
1080865526 11:36191183-36191205 GCCCTTTGTCCAGACAGTGGTGG + Intronic
1081064578 11:38524416-38524438 GGCCCCAGCCTTGACAGAGGTGG - Intergenic
1081549050 11:44095728-44095750 AGACTCGGCCCTGGCAGTGGCGG + Intronic
1081794656 11:45811149-45811171 GGCCTGTGCCCAGACAGTGCTGG + Exonic
1083228551 11:61300314-61300336 TTCCTCTGCCATGACAATGGTGG - Intronic
1083661718 11:64254543-64254565 GACCCCTGCCCTGCCCGTGGGGG + Intronic
1083682296 11:64357232-64357254 GGCCCCGGCGCTGACCGTGGAGG - Exonic
1083723087 11:64613078-64613100 GGCCTCTGCCCTTGCAGTACTGG - Intronic
1084519647 11:69655538-69655560 AGCCTCTCCCCTGAGGGTGGGGG + Intronic
1084746062 11:71170703-71170725 GGGCTCTGCCGTGACCTTGGAGG - Intronic
1085313671 11:75530857-75530879 GGCCTCTGTGCTGAGGGTGGAGG + Intergenic
1086941606 11:92803900-92803922 GGCCTCAGCACTGGGAGTGGGGG - Intronic
1088290377 11:108230655-108230677 GGCCTCTTCCCTGTAAGTAGAGG - Intronic
1090400320 11:126444719-126444741 GGTCTCAGCCCTGAGAGTGGTGG - Intronic
1091140183 11:133227995-133228017 GGACTCTGCCCTGAGAGCTGGGG + Intronic
1091686093 12:2563793-2563815 GGCTTCTGCCCTGGAAGTAGAGG + Intronic
1091753707 12:3038413-3038435 GCCCTCTGGCTTCACAGTGGAGG + Intronic
1096107292 12:49003766-49003788 AGTCTCAGCCCTGCCAGTGGTGG - Exonic
1096466651 12:51850366-51850388 GGGCTCTGCCCTGGCACAGGAGG + Intergenic
1096650938 12:53061699-53061721 GGTCTCTGCCCTGACAGCTGTGG - Intronic
1099373920 12:81872549-81872571 GGCCTCTCCCTTGACATGGGGGG + Intergenic
1100227335 12:92572495-92572517 GGCCTCTGACCTCATGGTGGAGG - Intergenic
1102304240 12:111792489-111792511 GGCATCAACCCTTACAGTGGTGG + Intronic
1103933189 12:124461216-124461238 GGTCTCTGCTCTGATCGTGGTGG + Intronic
1106409693 13:29502746-29502768 GCCCTCTGCCCGGTCAGGGGAGG - Intronic
1106413327 13:29525918-29525940 GGCCTCTGGCCTGAGAGGCGAGG - Intronic
1106685062 13:32049650-32049672 GGACTCTGCACTGAGAATGGAGG + Intronic
1106776658 13:33016277-33016299 TGCCTCCGCCCTGGCACTGGGGG - Intergenic
1106913859 13:34490685-34490707 AGGCTCTGTCCTGACAGTGCTGG + Intergenic
1109220272 13:59634433-59634455 CGCCTCTTCCCTGACAGTGTTGG - Intergenic
1110829338 13:80012477-80012499 GGCCTCTGCCCTACCACTGGTGG + Intergenic
1111920289 13:94402896-94402918 GGCCTCTCCCCTGACAGGTGGGG + Intronic
1112142685 13:96663104-96663126 GGCACCAGCCCTGACAGGGGTGG + Intronic
1113530406 13:111020421-111020443 GGGCTCTGCCCTGAAGGTGCTGG - Intergenic
1113853021 13:113428748-113428770 TGCCTCTGCCCTGACCTGGGAGG - Intronic
1113944386 13:114035638-114035660 GGCCGCTGCCCGCTCAGTGGGGG - Intronic
1118137456 14:63045410-63045432 CGCCGCTGCCCAGACTGTGGCGG + Exonic
1119412399 14:74441350-74441372 AGCTCCTGCCCTGGCAGTGGAGG + Intergenic
1119417235 14:74480335-74480357 GGTTATTGCCCTGACAGTGGAGG - Intronic
1119647902 14:76361746-76361768 GGCCTTAGCCCTGACATTGTTGG + Intronic
1121943128 14:98092350-98092372 GGCAGCTGTCCAGACAGTGGGGG + Intergenic
1122092772 14:99350963-99350985 GCCCTCTGTCCAGACAGGGGAGG - Intergenic
1122248525 14:100421691-100421713 GGCCACTCCCCTGACGTTGGTGG + Intronic
1122301607 14:100734291-100734313 GGCGTCTGCACTGACATTGGGGG + Exonic
1122535371 14:102458285-102458307 GGGCTCCACCCTGACAGTGGTGG - Intronic
1122789018 14:104176619-104176641 AGCCTGTGCCCAGAGAGTGGTGG + Exonic
1123088373 14:105729879-105729901 GGCCTTTTCCCTGGCAGAGGAGG - Intergenic
1124254655 15:28130956-28130978 GGCCTCTGCTCTGAGAGGGCTGG - Intronic
1125296354 15:38207700-38207722 TTCCTCTGCTCAGACAGTGGAGG - Intergenic
1125605615 15:40938289-40938311 GGGCACTGCCCTGCCAGTAGTGG + Exonic
1125814360 15:42571825-42571847 GGGCTGTGGCCGGACAGTGGCGG - Intergenic
1127981377 15:64037756-64037778 GGCCTCTCACTTGACAGTTGAGG - Intronic
1128262667 15:66243343-66243365 GGCCTGGGCCCTGACCGGGGAGG + Intronic
1128431426 15:67598537-67598559 CGCCTGTGCCCTGACAGTGTTGG + Intronic
1129414618 15:75368353-75368375 GGCCCCTGCCCTGCCCGCGGCGG + Intronic
1129460243 15:75696880-75696902 AGCCCTTGCCCTGACAGAGGGGG - Intronic
1130303958 15:82700370-82700392 TGCCACTGGCCTGCCAGTGGTGG + Intronic
1131142043 15:89984825-89984847 TGTCTCTGCCCTGTCACTGGTGG - Intergenic
1132558581 16:583427-583449 TGGCTCTGCCCTGGCTGTGGGGG + Exonic
1132731832 16:1366627-1366649 GGCCACTGCCGTGTCTGTGGTGG - Intronic
1132921301 16:2395903-2395925 GGCCTCTGTCATGACCATGGAGG + Intergenic
1133119340 16:3596597-3596619 GGCCTTGGCCGTGACAGAGGAGG - Intronic
1133224784 16:4335651-4335673 GGCCTCTGCGATCACAGAGGTGG - Intronic
1134124506 16:11607177-11607199 GGCACCTGCCCTGAGAGTGGGGG - Intronic
1137380594 16:47995495-47995517 GGCCTGTGCCATGACGGTAGGGG - Intergenic
1137655298 16:50153729-50153751 CGCCGCTGCTGTGACAGTGGTGG - Exonic
1138249077 16:55488698-55488720 GGCTTCTGCCCTGAGACCGGTGG + Exonic
1139967685 16:70754727-70754749 GGCCTCAGCCCAGAGAATGGAGG - Intronic
1141410308 16:83828561-83828583 ACCCTCTGCCCTGCCAGAGGCGG - Intergenic
1142311414 16:89316326-89316348 GGCGTCTCCCCTCACAGTGCAGG + Intronic
1143972980 17:10809155-10809177 GGTCTCTCCCTTGACAGTTGGGG - Intergenic
1144244961 17:13353585-13353607 GGCCCCTGCCCTGAGAGTGGAGG + Intergenic
1145311628 17:21704114-21704136 GGCCTCTCCCCGGCCAGGGGTGG - Exonic
1146660162 17:34660255-34660277 GGGCTCTGCCCTAACACTGATGG + Intergenic
1147338751 17:39741605-39741627 GGCCTTTGCCCTGACCCTGAGGG + Intronic
1148846503 17:50533001-50533023 GGCCCCCTCCCTGGCAGTGGCGG + Intronic
1148864147 17:50619848-50619870 GCCCTCTCCCCTGACCGTGCTGG + Intronic
1150577803 17:66445473-66445495 GGCCTGTGCCCTAAGAATGGGGG - Intronic
1150706160 17:67489257-67489279 GGCCTCTGTCCTCACAGATGTGG + Intronic
1151890465 17:76948171-76948193 GCCCTCAGCCCTGCCAGTGTGGG + Intronic
1152458717 17:80430482-80430504 CACCTCTGCCCTGACACGGGAGG + Intronic
1152529166 17:80906898-80906920 GACCTCTGCACTCACGGTGGGGG + Intronic
1152568164 17:81109506-81109528 GGCCTCTGTCCGGACAGGGAAGG + Intronic
1152584950 17:81184856-81184878 GGGCTCTGCACTGACGGTGAGGG - Intergenic
1152639180 17:81442585-81442607 GGCCTGTGCCGTGGCAGGGGAGG + Exonic
1152685088 17:81689989-81690011 GGCCTCTGTCCTCACTGTGGCGG - Intronic
1152723925 17:81936020-81936042 GGCCCCTGCCCTCACTGGGGTGG + Intronic
1152902009 17:82947649-82947671 GGCCTCTGGCAGGACAGAGGAGG + Intronic
1153075843 18:1160858-1160880 GGCCCCTCCCCTGACACAGGAGG + Intergenic
1153466800 18:5397198-5397220 GGGCTCTGCCTTGACGGAGGGGG - Exonic
1155189066 18:23413485-23413507 GGCAACTGCCCTTACAGTGGAGG - Intronic
1156339641 18:36199889-36199911 GTCCTCTGGCCTGACCGGGGTGG - Exonic
1157269890 18:46265258-46265280 GGCCTCTGCCCTGACAGTGGGGG - Exonic
1158326074 18:56315073-56315095 GCCCCCTGCCCTAACAGTTGAGG + Intergenic
1160303031 18:77703818-77703840 AGCCTCTGCTCTGAGAATGGAGG - Intergenic
1160766790 19:812417-812439 GGGCCCGGCCCTGAGAGTGGGGG + Intergenic
1160819387 19:1050934-1050956 GGCCTCTTCCCACCCAGTGGTGG + Exonic
1161118546 19:2512704-2512726 TCCCTCTGCCCTGGCAGCGGGGG + Exonic
1161775459 19:6259675-6259697 GGCCTCTGTCCTGAGAGAGAGGG + Intronic
1162512999 19:11131086-11131108 GGCTTTTGCCCTGAGAGCGGTGG + Intronic
1163530817 19:17847902-17847924 GGGCTCGGCCCAGACACTGGGGG - Intronic
1163723108 19:18907536-18907558 GGCAGCTGCCCTGGCAGTGGGGG - Intronic
1165158859 19:33804197-33804219 GGCCTCTGTCCTGGGAGAGGCGG + Intronic
1165825667 19:38704501-38704523 CACCTTTGCCCTGAGAGTGGGGG + Intronic
1167049284 19:47068790-47068812 CGCCTGTGCCCTGCCAGAGGAGG - Intronic
1167077598 19:47258758-47258780 GGCCTTTATCCTGACAGTGATGG - Intronic
1167444208 19:49527951-49527973 GGGCTCTGCGCTGCCAGAGGCGG + Exonic
1167522739 19:49965681-49965703 GGCCCCCGCCTTGACAGAGGTGG + Intergenic
1167799653 19:51731933-51731955 CTCCTCTGCCCTGACTGTGGTGG - Intergenic
1167804583 19:51771954-51771976 CTCCTCTGTCCTGGCAGTGGAGG - Intronic
1168703468 19:58455000-58455022 AGCATCTGCCCTGACAGGTGTGG - Intronic
925535321 2:4910548-4910570 GGTTTCAGCCCTGGCAGTGGTGG - Intergenic
926113156 2:10195373-10195395 GGCCTCTGAGCGGACAGTGCTGG + Intronic
926647476 2:15305178-15305200 GGCCTCTCCCTTGACACTTGGGG - Intronic
926919072 2:17921798-17921820 GGCCCCTCCCCTGACACTTGGGG + Intronic
927435648 2:23064029-23064051 CTCCCCTGCCCTGACTGTGGTGG - Intergenic
927553043 2:24015734-24015756 TGCCTCTGGGCTGACAGAGGTGG - Intronic
927553055 2:24015852-24015874 TGCCTCTGGGCTGACAGAGGTGG - Intronic
928362803 2:30679360-30679382 GGCCTCTGATGTGAAAGTGGTGG - Intergenic
929033948 2:37672762-37672784 GGCCTCTGCCCTGAGACTCTCGG + Intronic
938580014 2:132637370-132637392 GGCCTCTGGCCTCAACGTGGTGG + Intronic
938602118 2:132853126-132853148 TTTCTCTGCCCTGAAAGTGGTGG - Intronic
939843688 2:147219224-147219246 GGTTTCTGCCATCACAGTGGTGG - Intergenic
940984895 2:160043160-160043182 GGCCTCTACCCTGAGGGTGGGGG + Intronic
942194079 2:173499617-173499639 GGTCTCTGCCGTGACATTGGTGG + Intergenic
944602978 2:201321838-201321860 GGTCTCAGCCTTGACAGAGGTGG - Intronic
947708955 2:232299217-232299239 GGCCGCTCCCCTGACTGTAGTGG + Intronic
948044851 2:234935758-234935780 GGCCTGTGCCCTCTCTGTGGAGG - Intergenic
948629822 2:239294880-239294902 GGCCTCTGCTCTGACTAAGGGGG + Intronic
948737559 2:240019121-240019143 GGCCTCTGCCCAGACACAGCAGG - Intronic
948972752 2:241441903-241441925 GGCCTCTGCCCAGCCTCTGGTGG + Intronic
1170102881 20:12721553-12721575 GGCCTCTGGTCTGAAGGTGGTGG - Intergenic
1171233154 20:23503781-23503803 CGCCTCTCACCTGAGAGTGGCGG - Intergenic
1171310528 20:24141333-24141355 TTCCCCTGCCCTCACAGTGGAGG - Intergenic
1171425354 20:25045342-25045364 GGCCTTTACCCTGCAAGTGGAGG - Intronic
1172655211 20:36532600-36532622 GCCACCTGCCCTGAGAGTGGAGG - Intergenic
1174404356 20:50293956-50293978 GGTCTCTGCCCTCACTATGGTGG + Intergenic
1175038185 20:56020340-56020362 AGCCTCTGCCCTCAAGGTGGTGG + Intergenic
1176253515 20:64138546-64138568 GGCCTCTGCCCACCCAATGGAGG - Intergenic
1176302054 21:5103052-5103074 GGCCTGTGCACTGGCAGTGGTGG + Intergenic
1179262960 21:39774862-39774884 GGCCTTTGCCCTGGCACTGATGG + Intronic
1179854975 21:44158848-44158870 GGCCTGTGCACTGGCAGTGGTGG - Intergenic
1179896351 21:44365738-44365760 TGCCTGTGGCCTGACAGTGAGGG + Intronic
1180026916 21:45169953-45169975 GGCATCTGCCCTGACTGCAGGGG + Intronic
1180239339 21:46489910-46489932 GACCACTGCCCAGAGAGTGGAGG + Intronic
1183253798 22:36747833-36747855 GGCCTCTGGCATGACACTAGTGG - Intergenic
1183301274 22:37060307-37060329 AGCGTCAGCCCTGGCAGTGGTGG - Intronic
1183544972 22:38450602-38450624 GGCCTTTGGGCTGACGGTGGTGG - Intronic
1184179237 22:42808635-42808657 GCCCTCTGGCCTGAAAGTGCTGG - Intronic
1184255063 22:43281827-43281849 GGACTGTGCCGTGACAGTGAAGG - Intronic
1184593967 22:45503183-45503205 GGCCTCGGCGCTGACAGTCCGGG - Intronic
1184658800 22:45955844-45955866 GGCCTCTGGCCTGAGACTGCAGG - Intronic
1184798287 22:46744671-46744693 GGCCTCTGCCCTGGCTGTGCTGG - Intergenic
1184852852 22:47130638-47130660 CACCTCTGCCCTGAGTGTGGTGG + Intronic
1184853667 22:47135141-47135163 GGCCTCTTCCCTGACAAGAGTGG + Intronic
950668157 3:14509615-14509637 GGCCTCTGCCCTGGCAGGCAGGG + Intronic
951529348 3:23684143-23684165 GGGTTCTGCCCTGAAACTGGAGG - Intergenic
953910435 3:46890030-46890052 TGCCTCTGCCCTGACTGAGGAGG - Intronic
954145372 3:48631792-48631814 GGCCTCTCCTCAGACAGTGCTGG - Exonic
954412836 3:50378478-50378500 GGCCTCTGCCCTGCCAAGGGCGG + Intronic
954647073 3:52138102-52138124 GCCCACTGCCCAGACAGTGAAGG + Intronic
956572695 3:70713913-70713935 GGCCTCTCCCCTGACAGATGGGG + Intergenic
959063607 3:101636592-101636614 GGCCACTGCCCTGCCAGTCCAGG + Intergenic
959969328 3:112391509-112391531 CACCTCTGCCCTGCCACTGGTGG + Intergenic
963610146 3:147456850-147456872 TGCCTCTGCCATCACACTGGTGG - Intronic
964801570 3:160564840-160564862 GGCCCCTTCCCCGGCAGTGGCGG - Intronic
965251824 3:166352248-166352270 AGCCTCTCCACTGCCAGTGGTGG - Intergenic
965688731 3:171333065-171333087 GGCCTCTTCCCTAAGAGTTGTGG - Intronic
968154197 3:196365593-196365615 AGCCTCTGGCCAGACAGTCGGGG + Intronic
968965906 4:3769014-3769036 GGCCTCTGGCCTAAGAGTGATGG - Intergenic
969362993 4:6677024-6677046 GTGCTCAGGCCTGACAGTGGGGG + Intergenic
969708902 4:8831596-8831618 GGCCTCTGGCCTGACAGATCTGG + Intergenic
972834679 4:42855553-42855575 GGCATGTTCCGTGACAGTGGAGG - Intergenic
973967174 4:56175063-56175085 GGCCCCTCCCCTGACAGGTGGGG + Intronic
977179054 4:93851305-93851327 GGCCTGTTTCCTGACTGTGGTGG + Intergenic
977586401 4:98779801-98779823 GGTCACTGCCTTGACAGAGGTGG + Intergenic
978679971 4:111368389-111368411 AACTTCTGCCCTGACAGTGTGGG - Intergenic
979613084 4:122710165-122710187 TCCCTCTGCCCTCAGAGTGGGGG + Intergenic
984286220 4:177732247-177732269 GGTCTCTGCCTTGACAGGTGGGG - Intronic
984338793 4:178427015-178427037 ATCCCCTGCCCTGGCAGTGGTGG + Intergenic
984592512 4:181632339-181632361 GGTCCCTCCCCTGACATTGGGGG + Intergenic
984868015 4:184299720-184299742 GGGCTGTGGCCAGACAGTGGCGG + Intergenic
985659614 5:1150353-1150375 GGCCTGTGCCCTGAAAATGAGGG - Intergenic
986275814 5:6274215-6274237 GGACTCAGCGTTGACAGTGGCGG + Intergenic
986374191 5:7113654-7113676 TTCCTGTGCCCTGGCAGTGGAGG + Intergenic
986685779 5:10274178-10274200 GGCCTCTCCCATGACACAGGGGG + Intergenic
991192384 5:63889432-63889454 GACCTCTGCCCTGACTGAGTGGG - Intergenic
991614007 5:68477120-68477142 GGCCTCTGGCCTGGCCATGGAGG + Intergenic
992181970 5:74206371-74206393 CTACTCTGCCCTGACAGGGGAGG - Intergenic
992666509 5:79014902-79014924 GGCCTCTGTCCTCAAAGTTGAGG + Intronic
993303824 5:86249845-86249867 GGCCTCTACCCTGACACATGGGG + Intergenic
993980733 5:94540469-94540491 GGTCTCTGCCATCACAATGGTGG + Intronic
994067358 5:95558194-95558216 AGCCTCTGTCCTGTAAGTGGGGG - Intronic
997210924 5:132076304-132076326 CCCCTCTGCTCTGACAGTGTTGG - Intergenic
998286902 5:140871131-140871153 GGCCTCTTCCCGGACTTTGGCGG + Exonic
998477178 5:142431878-142431900 GGCGTCTGGGGTGACAGTGGTGG + Intergenic
999735415 5:154509440-154509462 AGCCTTTGCCCTGAGAGTAGTGG + Intergenic
1001288664 5:170441180-170441202 GGCCTCTGCCCTGGCAGGGATGG + Intronic
1002312043 5:178320708-178320730 GGCCTCAGCCCTGGCCCTGGGGG - Intronic
1002434410 5:179222038-179222060 GGCCTCTGGGCTCAGAGTGGCGG - Intronic
1002660232 5:180786737-180786759 AGCCTGGGCCCTGACGGTGGAGG + Intergenic
1002710956 5:181194854-181194876 GGCTTCTGCCCTGACTGGGAAGG - Exonic
1003415299 6:5902166-5902188 AGGCTCAGCCCTAACAGTGGTGG + Intergenic
1006457193 6:34138590-34138612 CACCTCTGCCCAGCCAGTGGGGG - Intronic
1007470008 6:42083695-42083717 GGACTCTGCCATCACAGAGGAGG + Intronic
1007847509 6:44772154-44772176 GGCCCTGGCCCTGACAGAGGGGG - Intergenic
1009469144 6:64010277-64010299 TGCTCCTGCTCTGACAGTGGTGG + Intronic
1010238541 6:73595794-73595816 TGCCTCAGCCCAGAAAGTGGAGG - Intronic
1016824868 6:148378774-148378796 AGCCTCTTCCATGACAGAGGTGG + Intronic
1018060319 6:160084929-160084951 CGTCTCTGCCCTGACACAGGAGG - Intronic
1019452082 7:1104204-1104226 TGCCTCGGTGCTGACAGTGGAGG - Intronic
1019832757 7:3349509-3349531 GTCCTCTGCCCTCACAGGGCTGG - Intronic
1020142585 7:5620717-5620739 GGCCTCAACCCTGGCAGGGGAGG - Intronic
1020232545 7:6330916-6330938 GGCCTCTGGCTTCACAGTGGCGG - Exonic
1021769660 7:23985499-23985521 GGTCCCTGCCTTGACAGAGGTGG - Intergenic
1022660229 7:32360116-32360138 GGTCTCTGCCCTCTAAGTGGTGG - Intergenic
1023462796 7:40418818-40418840 TTCCTCTGCCCTGTCAGTGTTGG + Intronic
1023869052 7:44252873-44252895 GGCCTGTGCCCTTGGAGTGGAGG - Intronic
1025634459 7:63309516-63309538 GGCATCTTACCTGTCAGTGGGGG - Intergenic
1025648239 7:63438659-63438681 GGCATCTTACCTGTCAGTGGGGG + Intergenic
1026281719 7:68928184-68928206 GGCCCTTGACCTGACTGTGGTGG - Intergenic
1026352922 7:69533288-69533310 GGGCTCTGCCCTTACAGCCGTGG - Intergenic
1026481859 7:70786210-70786232 GGGGGCTGCCCTCACAGTGGTGG - Intronic
1028456252 7:91041064-91041086 TGCCTCTGCCCTGGCAGGTGTGG - Intronic
1029366014 7:100116903-100116925 GCACTCTGCCCTCAGAGTGGGGG + Intronic
1029436418 7:100566430-100566452 GGCCTCTGCCCAGCCAGGTGAGG - Exonic
1029645716 7:101854566-101854588 GGCCACTGCTCAGCCAGTGGGGG + Intronic
1029707408 7:102283099-102283121 GGCCTCCCCCGTGACAGTGACGG + Intronic
1030942032 7:115663335-115663357 GGCCTGTGCACTGGCAGTGAGGG + Intergenic
1033621104 7:143062693-143062715 TGCCTCTCACCTCACAGTGGTGG - Intergenic
1033833747 7:145283656-145283678 GCCCTATCCCCTGGCAGTGGGGG - Intergenic
1035243532 7:157547765-157547787 GCCCCCTGCCCTGACCATGGGGG + Intronic
1035471096 7:159109390-159109412 GGCCTCTGCCCTGAGCATGGAGG + Intronic
1035737077 8:1896917-1896939 GGTCTCTGACCTGGCAGTGATGG + Intronic
1035843266 8:2835329-2835351 GGCCCCTGCCCTGACACTTGGGG + Intergenic
1038643163 8:29343236-29343258 GTTCTCGTCCCTGACAGTGGTGG + Intronic
1038827741 8:31023439-31023461 AGCCTCTTCACTGGCAGTGGCGG + Intronic
1041443581 8:57925939-57925961 TGCCTCTGCCCTCAAAGTGCTGG + Intergenic
1043209343 8:77491538-77491560 GGCCCCTCCCCTGACAGAAGGGG - Intergenic
1045543223 8:103105770-103105792 GGCTTCTTCCCTGATGGTGGTGG - Intergenic
1047746853 8:127851593-127851615 AGTCTCTGACCTCACAGTGGAGG - Intergenic
1048220549 8:132537214-132537236 GCCCTCTTGCCTGACAGTTGTGG - Intergenic
1048474396 8:134730229-134730251 GGCCTTTGCCTTGTCACTGGGGG - Intergenic
1049259232 8:141629856-141629878 GCCCTCTGCCCTGACAGAGCTGG + Intergenic
1049273711 8:141709305-141709327 GGCCTGGGCCCTGACGGAGGTGG - Intergenic
1049600188 8:143504014-143504036 GGCCTCTGCCCTGTCCCAGGGGG - Intronic
1057078996 9:92158353-92158375 TGACTCTTCACTGACAGTGGTGG + Intergenic
1057083801 9:92190609-92190631 GACCTCTGCCCTGCCAGGTGAGG - Intergenic
1058431713 9:104926665-104926687 GGGCTCTGCCGTGAGGGTGGGGG - Intronic
1058743403 9:107966570-107966592 GACCTGGGCCCTGACACTGGTGG - Intergenic
1060013049 9:120061435-120061457 GACCTCTGCTCATACAGTGGGGG + Intergenic
1060880865 9:127117130-127117152 GGCATCAGCCAGGACAGTGGGGG - Intronic
1060981755 9:127796550-127796572 GGACTGTGCCCTGTAAGTGGGGG + Intronic
1061204724 9:129156326-129156348 GGCTTCTGCCCGGACTGTGGTGG + Intergenic
1062169433 9:135126779-135126801 CGCCTCTGCCCTCTCAGGGGAGG + Intergenic
1062352615 9:136146459-136146481 CACCTCTGCCCTGACTCTGGGGG - Intergenic
1062612906 9:137382998-137383020 GGCCTCAGGCCTGGCAGTGCTGG + Intronic
1187512866 X:19937995-19938017 GGCCTCAGCTCTGCCAGTGAGGG - Intronic
1189312429 X:40029118-40029140 GGCATCTGACATGGCAGTGGGGG + Intergenic
1189505291 X:41607057-41607079 GGCATCTGCCCTGTCAGTGCAGG - Intronic
1190887591 X:54543191-54543213 GTCCTCTGCCCTGCAGGTGGTGG + Exonic
1192399569 X:70821348-70821370 GGCCTCTCCCCCAACACTGGGGG - Intronic
1195694048 X:107653734-107653756 GGCTTCTGTCTTGGCAGTGGTGG + Intergenic
1200764057 Y:7065587-7065609 GGCCTCAGACTTAACAGTGGTGG - Intronic