ID: 1157272292

View in Genome Browser
Species Human (GRCh38)
Location 18:46285405-46285427
Sequence TCATGACCACACAGAGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157272292_1157272295 -1 Left 1157272292 18:46285405-46285427 CCATGCTCTCTGTGTGGTCATGA No data
Right 1157272295 18:46285427-46285449 AGAAAGTGATGTGTGAACAGGGG No data
1157272292_1157272296 0 Left 1157272292 18:46285405-46285427 CCATGCTCTCTGTGTGGTCATGA No data
Right 1157272296 18:46285428-46285450 GAAAGTGATGTGTGAACAGGGGG No data
1157272292_1157272294 -2 Left 1157272292 18:46285405-46285427 CCATGCTCTCTGTGTGGTCATGA No data
Right 1157272294 18:46285426-46285448 GAGAAAGTGATGTGTGAACAGGG No data
1157272292_1157272297 13 Left 1157272292 18:46285405-46285427 CCATGCTCTCTGTGTGGTCATGA No data
Right 1157272297 18:46285441-46285463 GAACAGGGGGATGTCCCGTTAGG No data
1157272292_1157272293 -3 Left 1157272292 18:46285405-46285427 CCATGCTCTCTGTGTGGTCATGA No data
Right 1157272293 18:46285425-46285447 TGAGAAAGTGATGTGTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157272292 Original CRISPR TCATGACCACACAGAGAGCA TGG (reversed) Intergenic
No off target data available for this crispr