ID: 1157272951

View in Genome Browser
Species Human (GRCh38)
Location 18:46290568-46290590
Sequence CCTCAGAGGCAGCCAGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157272938_1157272951 26 Left 1157272938 18:46290519-46290541 CCCATCTCTATTAAAAAGCAAAA No data
Right 1157272951 18:46290568-46290590 CCTCAGAGGCAGCCAGCGGGGGG No data
1157272941_1157272951 -4 Left 1157272941 18:46290549-46290571 CCTCTCTTCTCCCACTGTCCCTC No data
Right 1157272951 18:46290568-46290590 CCTCAGAGGCAGCCAGCGGGGGG No data
1157272939_1157272951 25 Left 1157272939 18:46290520-46290542 CCATCTCTATTAAAAAGCAAAAG No data
Right 1157272951 18:46290568-46290590 CCTCAGAGGCAGCCAGCGGGGGG No data
1157272940_1157272951 0 Left 1157272940 18:46290545-46290567 CCTGCCTCTCTTCTCCCACTGTC No data
Right 1157272951 18:46290568-46290590 CCTCAGAGGCAGCCAGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157272951 Original CRISPR CCTCAGAGGCAGCCAGCGGG GGG Intergenic
No off target data available for this crispr