ID: 1157275635

View in Genome Browser
Species Human (GRCh38)
Location 18:46309509-46309531
Sequence TAAAAATACAAAAACTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157275635_1157275641 3 Left 1157275635 18:46309509-46309531 CCCTGGTAGTTTTTGTATTTTTA No data
Right 1157275641 18:46309535-46309557 GAGATGGGGTTTTGCCACGTTGG 0: 268
1: 6292
2: 20384
3: 79072
4: 124178
1157275635_1157275643 12 Left 1157275635 18:46309509-46309531 CCCTGGTAGTTTTTGTATTTTTA No data
Right 1157275643 18:46309544-46309566 TTTTGCCACGTTGGCCAGGCTGG 0: 702
1: 15826
2: 45140
3: 144382
4: 203611
1157275635_1157275645 24 Left 1157275635 18:46309509-46309531 CCCTGGTAGTTTTTGTATTTTTA No data
Right 1157275645 18:46309556-46309578 GGCCAGGCTGGTCTCCATGTTGG No data
1157275635_1157275642 8 Left 1157275635 18:46309509-46309531 CCCTGGTAGTTTTTGTATTTTTA No data
Right 1157275642 18:46309540-46309562 GGGGTTTTGCCACGTTGGCCAGG 0: 436
1: 9799
2: 34046
3: 118410
4: 199821
1157275635_1157275647 29 Left 1157275635 18:46309509-46309531 CCCTGGTAGTTTTTGTATTTTTA No data
Right 1157275647 18:46309561-46309583 GGCTGGTCTCCATGTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157275635 Original CRISPR TAAAAATACAAAAACTACCA GGG (reversed) Intergenic
No off target data available for this crispr