ID: 1157275636

View in Genome Browser
Species Human (GRCh38)
Location 18:46309510-46309532
Sequence CTAAAAATACAAAAACTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232929
Summary {0: 34, 1: 3358, 2: 93800, 3: 74103, 4: 61634}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157275636_1157275645 23 Left 1157275636 18:46309510-46309532 CCTGGTAGTTTTTGTATTTTTAG 0: 34
1: 3358
2: 93800
3: 74103
4: 61634
Right 1157275645 18:46309556-46309578 GGCCAGGCTGGTCTCCATGTTGG No data
1157275636_1157275642 7 Left 1157275636 18:46309510-46309532 CCTGGTAGTTTTTGTATTTTTAG 0: 34
1: 3358
2: 93800
3: 74103
4: 61634
Right 1157275642 18:46309540-46309562 GGGGTTTTGCCACGTTGGCCAGG 0: 436
1: 9799
2: 34046
3: 118410
4: 199821
1157275636_1157275647 28 Left 1157275636 18:46309510-46309532 CCTGGTAGTTTTTGTATTTTTAG 0: 34
1: 3358
2: 93800
3: 74103
4: 61634
Right 1157275647 18:46309561-46309583 GGCTGGTCTCCATGTTGGCCAGG No data
1157275636_1157275641 2 Left 1157275636 18:46309510-46309532 CCTGGTAGTTTTTGTATTTTTAG 0: 34
1: 3358
2: 93800
3: 74103
4: 61634
Right 1157275641 18:46309535-46309557 GAGATGGGGTTTTGCCACGTTGG 0: 268
1: 6292
2: 20384
3: 79072
4: 124178
1157275636_1157275643 11 Left 1157275636 18:46309510-46309532 CCTGGTAGTTTTTGTATTTTTAG 0: 34
1: 3358
2: 93800
3: 74103
4: 61634
Right 1157275643 18:46309544-46309566 TTTTGCCACGTTGGCCAGGCTGG 0: 702
1: 15826
2: 45140
3: 144382
4: 203611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157275636 Original CRISPR CTAAAAATACAAAAACTACC AGG (reversed) Intergenic
Too many off-targets to display for this crispr