ID: 1157275645

View in Genome Browser
Species Human (GRCh38)
Location 18:46309556-46309578
Sequence GGCCAGGCTGGTCTCCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157275636_1157275645 23 Left 1157275636 18:46309510-46309532 CCTGGTAGTTTTTGTATTTTTAG 0: 34
1: 3358
2: 93800
3: 74103
4: 61634
Right 1157275645 18:46309556-46309578 GGCCAGGCTGGTCTCCATGTTGG No data
1157275634_1157275645 29 Left 1157275634 18:46309504-46309526 CCATGCCCTGGTAGTTTTTGTAT No data
Right 1157275645 18:46309556-46309578 GGCCAGGCTGGTCTCCATGTTGG No data
1157275635_1157275645 24 Left 1157275635 18:46309509-46309531 CCCTGGTAGTTTTTGTATTTTTA No data
Right 1157275645 18:46309556-46309578 GGCCAGGCTGGTCTCCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157275645 Original CRISPR GGCCAGGCTGGTCTCCATGT TGG Intergenic
No off target data available for this crispr