ID: 1157276480

View in Genome Browser
Species Human (GRCh38)
Location 18:46314331-46314353
Sequence CCTCAGTGTTACCTCGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157276480_1157276488 19 Left 1157276480 18:46314331-46314353 CCTTGATCGAGGTAACACTGAGG No data
Right 1157276488 18:46314373-46314395 CAGAGTTCCCCTGCAGGATTGGG No data
1157276480_1157276487 18 Left 1157276480 18:46314331-46314353 CCTTGATCGAGGTAACACTGAGG No data
Right 1157276487 18:46314372-46314394 CCAGAGTTCCCCTGCAGGATTGG No data
1157276480_1157276484 13 Left 1157276480 18:46314331-46314353 CCTTGATCGAGGTAACACTGAGG No data
Right 1157276484 18:46314367-46314389 GTCTCCCAGAGTTCCCCTGCAGG No data
1157276480_1157276489 25 Left 1157276480 18:46314331-46314353 CCTTGATCGAGGTAACACTGAGG No data
Right 1157276489 18:46314379-46314401 TCCCCTGCAGGATTGGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157276480 Original CRISPR CCTCAGTGTTACCTCGATCA AGG (reversed) Intergenic
No off target data available for this crispr