ID: 1157279321

View in Genome Browser
Species Human (GRCh38)
Location 18:46335248-46335270
Sequence ACAAAGCAGCGGGCCGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 68}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157279305_1157279321 12 Left 1157279305 18:46335213-46335235 CCCCCACGCCAGGCCTTTGCCCC 0: 1
1: 0
2: 7
3: 139
4: 1118
Right 1157279321 18:46335248-46335270 ACAAAGCAGCGGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1157279316_1157279321 -9 Left 1157279316 18:46335234-46335256 CCGGGCAGCGGTTGACAAAGCAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1157279321 18:46335248-46335270 ACAAAGCAGCGGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1157279306_1157279321 11 Left 1157279306 18:46335214-46335236 CCCCACGCCAGGCCTTTGCCCCG 0: 1
1: 0
2: 2
3: 20
4: 211
Right 1157279321 18:46335248-46335270 ACAAAGCAGCGGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1157279314_1157279321 -7 Left 1157279314 18:46335232-46335254 CCCCGGGCAGCGGTTGACAAAGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1157279321 18:46335248-46335270 ACAAAGCAGCGGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1157279311_1157279321 4 Left 1157279311 18:46335221-46335243 CCAGGCCTTTGCCCCGGGCAGCG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1157279321 18:46335248-46335270 ACAAAGCAGCGGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1157279307_1157279321 10 Left 1157279307 18:46335215-46335237 CCCACGCCAGGCCTTTGCCCCGG 0: 1
1: 0
2: 3
3: 15
4: 224
Right 1157279321 18:46335248-46335270 ACAAAGCAGCGGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1157279315_1157279321 -8 Left 1157279315 18:46335233-46335255 CCCGGGCAGCGGTTGACAAAGCA 0: 1
1: 0
2: 3
3: 6
4: 101
Right 1157279321 18:46335248-46335270 ACAAAGCAGCGGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1157279309_1157279321 9 Left 1157279309 18:46335216-46335238 CCACGCCAGGCCTTTGCCCCGGG 0: 1
1: 0
2: 0
3: 21
4: 218
Right 1157279321 18:46335248-46335270 ACAAAGCAGCGGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1157279313_1157279321 -1 Left 1157279313 18:46335226-46335248 CCTTTGCCCCGGGCAGCGGTTGA 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1157279321 18:46335248-46335270 ACAAAGCAGCGGGCCGGCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157279321 Original CRISPR ACAAAGCAGCGGGCCGGCGC GGG Intronic
900564034 1:3323656-3323678 ACAAAGGCGAGGGCCGGTGCTGG + Intronic
903192608 1:21665371-21665393 ACAAAGCACCGGGCTGTGGCAGG + Intronic
905672085 1:39798494-39798516 ACTAAGCAGAGTGCAGGCGCAGG + Intergenic
906062647 1:42958534-42958556 ACAGCGCAGCGGGGCGGCGGGGG + Intronic
912812210 1:112803011-112803033 ACAAAGAAGCAGGCAGGGGCAGG - Intergenic
914813675 1:151047855-151047877 CCACAGCAGCGCGCCGGCGGCGG - Exonic
922119042 1:222644248-222644270 CCAAAGGAGCCGGCCGGCGAGGG - Intronic
1064043814 10:11992856-11992878 AGAAAGCAGCAGTCAGGCGCAGG + Intronic
1067572781 10:47384170-47384192 ACAGAGCCGCGAGCGGGCGCGGG - Intronic
1071808590 10:89152642-89152664 ACAAAGGAGTGGGCCAGGGCTGG - Intergenic
1072253732 10:93601243-93601265 ATAAAGCAGCGGGGCGGCCGCGG - Intronic
1075747905 10:124740898-124740920 ACAAAGCACATGGCCGGAGCTGG - Intronic
1076395092 10:130132652-130132674 AAAAATCAGCGGGCCGGGGGCGG + Intergenic
1077408058 11:2391441-2391463 ACAAAGAGGTGGGACGGCGCAGG - Intronic
1084087681 11:66862034-66862056 ACAGAGCAACGGGCAGGGGCAGG + Intronic
1084122160 11:67075976-67075998 ACAAAGCAGGGGTCCAGGGCTGG - Intergenic
1097995392 12:65882400-65882422 ACAAAGCAGCCCGCCCGCCCTGG + Intronic
1100619415 12:96256822-96256844 AGGAGGCAGCGGGCCGGGGCAGG + Intronic
1103807470 12:123584553-123584575 AGAAGGCAGCGGGGCGGCGGCGG + Exonic
1104585518 12:130045236-130045258 ACAAAGCAGCTGGGCTGCTCAGG - Intergenic
1113794836 13:113050907-113050929 ACAAAGCAGCTGGCTGCCGAGGG + Intronic
1121405629 14:93717702-93717724 ACAAAGCAGCGGGGTGGTGGCGG + Intergenic
1121776189 14:96592689-96592711 ACTGAGCCGAGGGCCGGCGCGGG - Intergenic
1121958979 14:98240935-98240957 ACAAAGCAGGGGGCAGGGGCTGG - Intergenic
1123023070 14:105411338-105411360 ACAGGGCAGCGGGTCGGCGAGGG - Intronic
1125533606 15:40429603-40429625 GCAAAGCAGGGGGCGGGGGCAGG + Intronic
1129150506 15:73684874-73684896 ACGAAGCCACCGGCCGGCGCTGG + Intronic
1130355934 15:83130372-83130394 ACAGAGCAGCTGGCAGCCGCAGG + Exonic
1131050243 15:89342998-89343020 GCAAAGCAGAGGGCCTGGGCTGG + Intergenic
1140908363 16:79429331-79429353 ACAAAGCAGAGGACCGACGGAGG + Intergenic
1142863288 17:2776447-2776469 ACAAAGGCGCGGGGCGGGGCAGG - Intergenic
1147179410 17:38674814-38674836 ACAAAGCGGCCGGCGGCCGCGGG + Exonic
1148553510 17:48564432-48564454 ACAAAGCCGGGGGCGGGGGCGGG - Intronic
1151593210 17:75060572-75060594 AAAGAGCAGCTGGCCGGCGCCGG + Intronic
1151840660 17:76615181-76615203 TCAGAGCGGCTGGCCGGCGCTGG - Intergenic
1152201223 17:78947540-78947562 CCAAAGCTGCGGGACGGGGCTGG + Intergenic
1152785735 17:82247034-82247056 ACAAAGGAGGGGGCCCGCCCTGG + Intronic
1154174558 18:12076789-12076811 ACAAAGGAGCACGTCGGCGCCGG - Intergenic
1157279321 18:46335248-46335270 ACAAAGCAGCGGGCCGGCGCGGG + Intronic
1161366135 19:3880820-3880842 ACAAAAGAGCTGGCGGGCGCTGG + Exonic
1163527672 19:17831139-17831161 GCAAAGCAGCGGGAGGGGGCGGG + Intronic
1168581635 19:57559897-57559919 AGAAGGCAGTGGGCCGGCGCAGG - Intergenic
926268145 2:11344545-11344567 CCATGGCAGCGGGCCGGCGGCGG - Exonic
935593749 2:104863918-104863940 ACAAAGCCGCCGGCCGCCTCCGG - Intergenic
944104850 2:196068859-196068881 GCTAAGCAACGGGCCCGCGCAGG + Intergenic
1170568285 20:17618803-17618825 TCACAGCATCGGGCCGGCACAGG + Intronic
1171792038 20:29536196-29536218 ACACAGCTGGGGGCCGGCGGAGG + Intergenic
1172270740 20:33654453-33654475 ACAAAGCAGGTGCCCAGCGCAGG + Intergenic
1175180316 20:57142233-57142255 GCAAAGCAGCGGGCAAGGGCGGG - Intergenic
1175913839 20:62416584-62416606 ACAAAGCCCCCAGCCGGCGCTGG - Intronic
961236965 3:125375356-125375378 ACAATGCACCGGGCCGGCAGTGG - Intergenic
968286676 3:197513049-197513071 ACAGAGCAGCAGGCAGGGGCAGG + Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
969054979 4:4396046-4396068 CCCAAGCAGCTGGCCGCCGCTGG - Intronic
969665950 4:8557771-8557793 CCAAAGCAGCGGGTCAGCGGGGG - Intergenic
970007789 4:11427789-11427811 CCAAAGCCGGGTGCCGGCGCGGG - Intronic
973619450 4:52712459-52712481 ACAAACCAGAGAGGCGGCGCGGG - Intergenic
974784178 4:66596788-66596810 GCAAAGCAGCTGGCCTGAGCAGG + Intergenic
992550109 5:77851855-77851877 ACAAAGCAAAGGGCCCGAGCGGG + Intronic
993898744 5:93570639-93570661 ACAAAGCACCGGGCCTGCGCCGG - Intergenic
1010332874 6:74645701-74645723 ACAAAGCAGCTGGCAGGTCCAGG + Intergenic
1013227978 6:108134208-108134230 GAAAAGCAGAGGGCCGGGGCAGG - Intronic
1013330311 6:109094572-109094594 CCTCAGCAGCCGGCCGGCGCCGG + Exonic
1017888765 6:158622138-158622160 ACATACCAGAGGGCAGGCGCTGG - Intronic
1018147086 6:160901495-160901517 ACAAAGAAGTGGCCAGGCGCGGG + Intergenic
1020066242 7:5190448-5190470 GAAGAGCAGCTGGCCGGCGCCGG - Exonic
1020131951 7:5563603-5563625 ACGATGCAGCGGGGCGGCCCTGG + Intronic
1038295927 8:26291292-26291314 ACACAGCCGCGGCCTGGCGCAGG + Intergenic
1040423434 8:47261039-47261061 GGGAAGCGGCGGGCCGGCGCGGG + Intronic
1049352820 8:142173142-142173164 ACAAGGCCCCGGGCCGGAGCAGG + Intergenic
1053139996 9:35676233-35676255 GCAAAGGAGCGGGGCGGAGCGGG + Intronic
1062005646 9:134237269-134237291 ACACAGCAGCTGCCCAGCGCTGG + Intergenic
1186630342 X:11341588-11341610 ACAAAGCAGAGGTCAGGCGTGGG - Intronic
1187974699 X:24693701-24693723 AGAAAGAAGCGGTCGGGCGCTGG - Intergenic