ID: 1157279770

View in Genome Browser
Species Human (GRCh38)
Location 18:46338733-46338755
Sequence CTAAAATGCCTCATTTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157279770_1157279774 26 Left 1157279770 18:46338733-46338755 CCTTGCTAAATGAGGCATTTTAG 0: 1
1: 0
2: 1
3: 21
4: 158
Right 1157279774 18:46338782-46338804 AAATTCCTGGTTCTTTCAAAGGG 0: 1
1: 0
2: 4
3: 24
4: 332
1157279770_1157279772 13 Left 1157279770 18:46338733-46338755 CCTTGCTAAATGAGGCATTTTAG 0: 1
1: 0
2: 1
3: 21
4: 158
Right 1157279772 18:46338769-46338791 GAGTTGATTAAAGAAATTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 221
1157279770_1157279773 25 Left 1157279770 18:46338733-46338755 CCTTGCTAAATGAGGCATTTTAG 0: 1
1: 0
2: 1
3: 21
4: 158
Right 1157279773 18:46338781-46338803 GAAATTCCTGGTTCTTTCAAAGG 0: 1
1: 0
2: 1
3: 32
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157279770 Original CRISPR CTAAAATGCCTCATTTAGCA AGG (reversed) Intronic
901740769 1:11340213-11340235 CCAAAATGCTCCATTTAGCTGGG - Intergenic
905223455 1:36464552-36464574 CTAAAATGCCACTTTTTGGAGGG + Intergenic
906309641 1:44744471-44744493 GTAAACTGCCTCATTTGCCAGGG - Intronic
912250077 1:108002149-108002171 CTAGAATGCCACAATTAGTATGG + Intergenic
915802631 1:158810221-158810243 CTAATAAGCCTCATTCAGGAAGG + Intergenic
919100517 1:193091663-193091685 CTAAAATGATTTATTTAGTAGGG - Intronic
919178825 1:194055987-194056009 CTAAAGTGTTTCATTCAGCAAGG - Intergenic
919357239 1:196538627-196538649 ATAATGTGCCTCATGTAGCATGG + Intronic
919983745 1:202658690-202658712 CTAAAAGTCCTCATTTCCCAGGG + Intronic
1063957185 10:11278054-11278076 CTAAAATGCCACATTTATATGGG + Intronic
1065135696 10:22667141-22667163 GTAAAATGCCTTATTTTGCCAGG + Intronic
1070031592 10:72682370-72682392 CTAGAATGCATCCTTTAGGATGG - Intergenic
1070265453 10:74897939-74897961 CTAAAATTCCTAATTTAACATGG - Intronic
1074628973 10:115228447-115228469 ATGAGATGCCTCATTTAACAAGG - Intronic
1076446555 10:130518175-130518197 CTGAAATGCCTCAGGTACCAAGG - Intergenic
1078183615 11:9032570-9032592 CTAAAATACAAAATTTAGCAGGG + Intronic
1080704435 11:34677135-34677157 CTAAAATGTCTAAGTTAGAAGGG + Intergenic
1085742979 11:79092651-79092673 CTAACTTGACTCATTGAGCAGGG - Intronic
1085815817 11:79735981-79736003 CCAAAATGCCACATTTAGTAGGG - Intergenic
1086829064 11:91536624-91536646 CTAAAATGCCTCATATGTTATGG + Intergenic
1087290216 11:96313170-96313192 CTAAGATCCCACAATTAGCAAGG + Intronic
1088010882 11:104999503-104999525 CTGATGTGCCTCACTTAGCATGG + Intronic
1089041174 11:115451730-115451752 CTTATATGCCTAAATTAGCAAGG - Intronic
1089105277 11:115997914-115997936 CCAAAATGCCTCATTTTGGAGGG - Intergenic
1090439097 11:126711706-126711728 CTAAAAGGTCTGATTTAGTAAGG + Intronic
1095512279 12:42965445-42965467 GTACACTGCCTCATTCAGCAAGG - Intergenic
1095997144 12:48097614-48097636 CTATAATGCCTGATTTCTCAAGG - Intronic
1097760118 12:63454610-63454632 TTAAAATGCCACCTTTAGCTTGG + Intergenic
1098810019 12:75075821-75075843 TTACAATGCCTCCTTTAGAATGG + Intronic
1098949371 12:76623679-76623701 ATAAAATGGTTCATTTTGCAGGG + Intergenic
1100286995 12:93176099-93176121 CTAATATGCCTTATTTTTCATGG - Intergenic
1101799156 12:108005600-108005622 TTAAAATTCTTTATTTAGCATGG - Intergenic
1106123957 13:26884913-26884935 CCAAAATGCCTCATGTTGGAAGG + Intergenic
1106459213 13:29954022-29954044 TTAAGATGTCTCATTTAGAAAGG + Intergenic
1110520313 13:76468448-76468470 CTAAAATTCTTTATTCAGCAAGG + Intergenic
1111755472 13:92389448-92389470 CAAAAATGCATCATGTATCATGG + Intronic
1114345071 14:21786209-21786231 CTAAAAAACCTTATTTTGCAAGG + Intergenic
1116867624 14:50043856-50043878 CTAAAATGCCACCATTAGTAAGG + Intergenic
1117237405 14:53793000-53793022 CAAAAATGGCTCTTTTAGTAGGG - Intergenic
1117895102 14:60476074-60476096 CTAAACTGTCCCCTTTAGCAAGG + Intronic
1118406941 14:65434153-65434175 CTAAAATGCCTTATACAGAAAGG + Intronic
1119494397 14:75066189-75066211 TTGAAATGCATAATTTAGCATGG - Intronic
1120517842 14:85491324-85491346 ATAAAATGCCTCACTTATAAGGG + Intergenic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1130167376 15:81475774-81475796 CCAAAATACCACATTTATCATGG - Intergenic
1131473749 15:92718319-92718341 CTAAATTGTTTAATTTAGCAGGG - Intronic
1131824199 15:96304554-96304576 CTATCATGCCTCTTTTATCATGG - Intergenic
1133081624 16:3325829-3325851 CCTACATGCCTCATTTAGCATGG - Intergenic
1133843440 16:9430810-9430832 CTAAATTCCTTCATTTAGCTTGG - Intergenic
1136632939 16:31499679-31499701 CTAAAATGCCACCATTAGCTGGG + Intronic
1138886272 16:61082944-61082966 CAAAAATGCCTTCTTTAGGAAGG - Intergenic
1139242502 16:65407920-65407942 CCAAAATGCATCATTTCTCACGG - Intergenic
1143023216 17:3927275-3927297 CTAAAATGTCTCAGCCAGCACGG - Intronic
1143556976 17:7668067-7668089 TTTAAATGTCTGATTTAGCAAGG - Intronic
1143792265 17:9307156-9307178 ATAAAATGACTCGTTTACCAAGG + Intronic
1146071614 17:29687212-29687234 CTCAAATGACCCATTTAGCAAGG + Intronic
1146979089 17:37142544-37142566 CTAAAATGCCCTCTTTAGAAAGG + Intronic
1148288752 17:46421224-46421246 CTTAAATTCCTCATTTGGCCAGG - Intergenic
1148310921 17:46638801-46638823 CTTAAATTCCTCATTTGGCCAGG - Intronic
1153834720 18:8953664-8953686 CAACAAAGCCTCATTTAGCCTGG - Intergenic
1156102107 18:33608877-33608899 TTAAAATGTATTATTTAGCAAGG + Intronic
1157162561 18:45327387-45327409 CTGAGCTGTCTCATTTAGCATGG - Intronic
1157279770 18:46338733-46338755 CTAAAATGCCTCATTTAGCAAGG - Intronic
1158048129 18:53181687-53181709 CTAACATGCCTCATGCAGCCTGG - Intronic
1158111053 18:53942066-53942088 CTAATGTGCCTCATGTGGCATGG + Intergenic
1159491228 18:69137485-69137507 TGAAAATGCCTAATGTAGCAAGG + Intergenic
1160040524 18:75340906-75340928 CTAAAATGCGTGATTTTGCAAGG - Intergenic
1163885682 19:19962734-19962756 CTATAATGCCTCTCTTTGCAAGG - Intergenic
1164383019 19:27751524-27751546 TTAAAATGCCTCAGTTGGCCAGG + Intergenic
927742638 2:25586204-25586226 TTAAAATGCTTCATTAAGCACGG + Intronic
929956603 2:46463265-46463287 CAAAAATGGCTCATTTTACAGGG - Intronic
930286699 2:49438205-49438227 CAAAAATGCCTCATTAAGGTTGG + Intergenic
931107854 2:59076940-59076962 CTTCATTGCCTCAATTAGCATGG - Intergenic
932096502 2:68854743-68854765 CTTAAATACATCATTTAGCTTGG + Intergenic
932196806 2:69791053-69791075 CTAAAATTCCTCATGGAACAAGG - Intronic
937647423 2:124281442-124281464 GTAAAATATCTCATTGAGCATGG + Intronic
938715226 2:134013364-134013386 CTAAAAAGCCTCATACAGGAAGG + Intergenic
939036099 2:137133220-137133242 CTAAAATTCCTCATGTAGTAAGG + Intronic
942544639 2:177050494-177050516 TTAAAATGCCTCAATGAGAAAGG - Intergenic
942553807 2:177150355-177150377 CTAAAATAACTTATTTTGCAGGG - Intergenic
943795155 2:191983367-191983389 CTAAGATGCATCATTAATCATGG - Intronic
945449711 2:209979405-209979427 TTAAATGGCCTCATTAAGCAAGG + Intronic
948604808 2:239128243-239128265 CTGAAATGCCTTCTTTAGGATGG - Intronic
1169866957 20:10212149-10212171 CTCAAATGCCACATTTACAAAGG - Intergenic
1176204551 20:63881198-63881220 CTAAAAAGACAAATTTAGCAGGG + Intronic
1177713156 21:24806047-24806069 CTAAAAAGCCGCTTTTATCATGG + Intergenic
1178820393 21:35970037-35970059 TTAAAATGCCTCCTTTGGCAGGG + Intronic
949797456 3:7866644-7866666 AGAAAATGCCTCTTTTGGCATGG + Intergenic
950171578 3:10842482-10842504 CTTAAAGGCCTCATTTAATAAGG + Intronic
950808717 3:15631474-15631496 TTAAGATGAATCATTTAGCAAGG + Exonic
951250135 3:20384695-20384717 TTAAAATCCCTTATTTACCAAGG + Intergenic
952640387 3:35587276-35587298 CTAAAATGCCCATTTTAGCCAGG + Intergenic
955724245 3:61915626-61915648 CTAAAAGGCCTCATTCAGCAAGG - Intronic
957806953 3:85160164-85160186 CTGAAAACCCTCATTTAGAAAGG - Intronic
962160160 3:132990455-132990477 CAAAAGTGCCTTATATAGCATGG - Intergenic
962894962 3:139705736-139705758 TTAAAAAGTCTTATTTAGCATGG + Intergenic
966100220 3:176259933-176259955 GTACAAAGCCTCATTTAGAAAGG - Intergenic
967644871 3:191910407-191910429 CTAATCTGCCTCTATTAGCAGGG + Intergenic
967678015 3:192323793-192323815 CTAAAATATCTCATGTGGCAGGG + Intronic
968563674 4:1298078-1298100 CTAAAATGCCTCAAGAAGCATGG - Intronic
970749896 4:19345807-19345829 GGAAAATGCCTTAATTAGCAAGG + Intergenic
971250767 4:24971468-24971490 CTAACGTGCCTCATGTGGCAAGG - Intronic
976466368 4:85373564-85373586 CTTAAATGCCATATTTAGGAAGG - Intergenic
976511838 4:85919918-85919940 AAAAGATGCTTCATTTAGCATGG - Intronic
977914790 4:102579206-102579228 TTAAAATACCTCATTTAACCTGG - Intronic
979770748 4:124522145-124522167 CTAAAGTGCCTCATTTTCCAGGG + Intergenic
983036372 4:162872087-162872109 TTAAAATGCAACTTTTAGCATGG + Intergenic
986835239 5:11629936-11629958 TTAAAATGCCTCATTTTATAGGG + Intronic
989045590 5:37270322-37270344 CTAAAATGCCTGATTTCCCTTGG - Intergenic
992173688 5:74128584-74128606 CTAAAATACCTGATTTATAAAGG + Intergenic
992225251 5:74614132-74614154 AATAAATGCCTCATCTAGCATGG - Intergenic
993229725 5:85218854-85218876 CTAAATTGTCTCATCTGGCATGG - Intergenic
993829944 5:92742978-92743000 CTAAAATGCATATTTTAACAAGG - Intergenic
993874772 5:93293441-93293463 CAAAAATGGCTCATTGAGCTAGG + Intergenic
994268274 5:97744006-97744028 CTACAATGCTTCATTTTGAAAGG - Intergenic
994471557 5:100214592-100214614 ATAAAATGCATCATGGAGCAAGG + Intergenic
994843025 5:104950904-104950926 CTAAAATGTCTCATTTAAAGGGG - Intergenic
995166183 5:109044474-109044496 ATAAAATGCCTCATTTGGCCAGG - Intronic
1000465629 5:161572544-161572566 CTTAAATGCCTCATCTCCCAAGG + Intronic
1001645535 5:173278997-173279019 ACAAAATGCCTCATGGAGCAAGG + Intergenic
1001690263 5:173627729-173627751 CTAAAATGCTTTATTGAGGAAGG + Intergenic
1001862459 5:175069412-175069434 CTACAATACCTCCTTTAGGAAGG - Intergenic
1004432307 6:15556124-15556146 TTAAAATGCCCAATTTAGCAGGG + Intronic
1004726013 6:18311978-18312000 ATAAAATGCCTCATGTTGAAAGG - Intergenic
1005317421 6:24617660-24617682 CAAAAATGCCTCATAAAGCCAGG + Intronic
1005426180 6:25705054-25705076 CTAAAATGCTTCATATACAAAGG - Intergenic
1007793333 6:44326961-44326983 CAAAAATCCCACATTTAGCAAGG - Intronic
1007851733 6:44809664-44809686 CTAAAATGCCTATTTTTGAAGGG - Intronic
1008713942 6:54265538-54265560 CTAAAATGCATCATCTAACAAGG - Intronic
1011992296 6:93537721-93537743 ATAAAATTCTTCATTTATCAAGG - Intergenic
1012832394 6:104220736-104220758 CTTAAATGCCTCAATTTCCATGG - Intergenic
1014897819 6:126925042-126925064 CTAAAATGCTTCCTTTAGAGAGG + Intergenic
1015252280 6:131139405-131139427 TTAATATGCTTTATTTAGCAAGG + Intronic
1015382149 6:132581708-132581730 CTACAATTCATCTTTTAGCAAGG + Intergenic
1016070786 6:139736325-139736347 CTAAAATACCTCTTTGAGGAAGG + Intergenic
1016685956 6:146882576-146882598 ATAAAAAGCCTCATTTTACAAGG + Intergenic
1017071812 6:150581690-150581712 CCAAAATGCCCTATTTTGCAAGG + Intergenic
1017418403 6:154246321-154246343 CTTAAAAGTCTCCTTTAGCAAGG + Intronic
1018488244 6:164264431-164264453 CCATAGTGCCTCATTTATCATGG + Intergenic
1019861479 7:3662482-3662504 TTGAAAAGCCCCATTTAGCAAGG + Intronic
1019952432 7:4384445-4384467 CTAAATTGCCATATTTTGCATGG - Intergenic
1020054768 7:5109880-5109902 CCAAAAAGCCTCTTTTAGCTGGG - Intergenic
1020876189 7:13697604-13697626 CTCAAATTCCTCAATTAACAAGG - Intergenic
1027684362 7:81264280-81264302 CTAATGTGCCTCATGTGGCATGG + Intergenic
1028645240 7:93088117-93088139 CTAAAAAGCTTCATGCAGCAAGG - Intergenic
1030506315 7:110427894-110427916 CTAAAATGTTTCTTTTAGCTAGG - Intergenic
1031305253 7:120117800-120117822 CTAAAATCCCTTACTTAACAAGG + Intergenic
1035153905 7:156896795-156896817 CTAACATGCTCCATTTAGCAAGG + Intergenic
1035153956 7:156897236-156897258 CTAACATGCTCCATTTAGCGAGG - Intergenic
1035795920 8:2356308-2356330 TTAAAAGGCCTTATTTAACATGG - Intergenic
1036395478 8:8366966-8366988 CTAAAATGCATGATGTAGCTGGG - Intronic
1037605265 8:20433043-20433065 CTAAAAGGCCTCATCTAGCCAGG - Intergenic
1038771354 8:30484321-30484343 TTAAAATGTTTCTTTTAGCAGGG + Intronic
1040632097 8:49226069-49226091 CTTAAATGCCTAATTAAGAAAGG + Intergenic
1041324299 8:56648656-56648678 CTGAGCTACCTCATTTAGCAAGG - Intergenic
1041952568 8:63520349-63520371 ATAAAATGTCTCATTTGGCTTGG - Intergenic
1043406532 8:79940291-79940313 CAATAATGCCTCATTTATCTAGG - Intronic
1044393494 8:91681302-91681324 ATAATCTGCCTCATTTACCATGG + Intergenic
1044451071 8:92336155-92336177 CCATAATGCCTCTTTAAGCAGGG - Intergenic
1044465782 8:92503104-92503126 TTAAAATGCCTCATTGAGAAAGG + Intergenic
1045109927 8:98930637-98930659 TTAAATTGCCTCATTTAGGAAGG + Intronic
1045154892 8:99456726-99456748 CTAAAACCCCTCAATAAGCATGG - Intronic
1049286067 8:141775928-141775950 CTTAAATGCAGCAGTTAGCACGG - Intergenic
1050561038 9:6834653-6834675 CTGAAGTGCCTCATCGAGCATGG + Intronic
1051619934 9:19040312-19040334 CTAATACGACTCATTTAGCATGG + Intronic
1051621469 9:19054184-19054206 CTGAAATGCTTCAGTGAGCATGG - Exonic
1053447393 9:38163651-38163673 CTCAACTGCCTGATTCAGCACGG - Intergenic
1053882430 9:42609760-42609782 TTAAAATGCCTCACTTGGCCAGG + Intergenic
1053890239 9:42684542-42684564 TTAAAATGCCTCACTTGGCCAGG - Intergenic
1054221455 9:62417228-62417250 TTAAAATGCCTCACTTGGCCAGG + Intergenic
1054229259 9:62491945-62491967 TTAAAATGCCTCACTTGGCCAGG - Intergenic
1055175144 9:73309422-73309444 CATAAATGCCTGATTTAGAAAGG - Intergenic
1056571374 9:87818734-87818756 CTAAAATACCTCTATTAGCAGGG - Intergenic
1057454377 9:95194282-95194304 CTAAAATGTCTCATTTTTAATGG + Intronic
1058338818 9:103868737-103868759 CTAAAATGTCTGATTGAGCCAGG - Intergenic
1058946105 9:109857839-109857861 CTATAATGCCTGACATAGCAAGG + Intronic
1061178488 9:129010885-129010907 CTAACATGCCTCATGCAGGAGGG + Intronic
1062147119 9:134995832-134995854 TTAAAATGACTCATTCTGCAAGG + Intergenic
1188332296 X:28889743-28889765 TTACAATGCCTCCTTTAGAAAGG - Intronic
1190436233 X:50428640-50428662 CTTCAATGCCTCCTTTCGCAGGG + Intronic
1199814564 X:151386351-151386373 CTAAAATGCCACTTCTTGCATGG - Intergenic