ID: 1157280690

View in Genome Browser
Species Human (GRCh38)
Location 18:46344727-46344749
Sequence GTCAGATTCTGGGAAGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 290}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157280676_1157280690 26 Left 1157280676 18:46344678-46344700 CCTGCCCCCTCTGCCTGTGACGT 0: 1
1: 0
2: 1
3: 29
4: 267
Right 1157280690 18:46344727-46344749 GTCAGATTCTGGGAAGGTGAGGG 0: 1
1: 0
2: 3
3: 40
4: 290
1157280683_1157280690 13 Left 1157280683 18:46344691-46344713 CCTGTGACGTTTGGGACTTCTGA 0: 1
1: 0
2: 1
3: 4
4: 80
Right 1157280690 18:46344727-46344749 GTCAGATTCTGGGAAGGTGAGGG 0: 1
1: 0
2: 3
3: 40
4: 290
1157280677_1157280690 22 Left 1157280677 18:46344682-46344704 CCCCCTCTGCCTGTGACGTTTGG 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1157280690 18:46344727-46344749 GTCAGATTCTGGGAAGGTGAGGG 0: 1
1: 0
2: 3
3: 40
4: 290
1157280682_1157280690 19 Left 1157280682 18:46344685-46344707 CCTCTGCCTGTGACGTTTGGGAC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1157280690 18:46344727-46344749 GTCAGATTCTGGGAAGGTGAGGG 0: 1
1: 0
2: 3
3: 40
4: 290
1157280679_1157280690 21 Left 1157280679 18:46344683-46344705 CCCCTCTGCCTGTGACGTTTGGG 0: 1
1: 0
2: 2
3: 15
4: 177
Right 1157280690 18:46344727-46344749 GTCAGATTCTGGGAAGGTGAGGG 0: 1
1: 0
2: 3
3: 40
4: 290
1157280684_1157280690 -10 Left 1157280684 18:46344714-46344736 CCAGACCTGAAAAGTCAGATTCT 0: 1
1: 0
2: 3
3: 39
4: 320
Right 1157280690 18:46344727-46344749 GTCAGATTCTGGGAAGGTGAGGG 0: 1
1: 0
2: 3
3: 40
4: 290
1157280681_1157280690 20 Left 1157280681 18:46344684-46344706 CCCTCTGCCTGTGACGTTTGGGA 0: 1
1: 0
2: 0
3: 9
4: 158
Right 1157280690 18:46344727-46344749 GTCAGATTCTGGGAAGGTGAGGG 0: 1
1: 0
2: 3
3: 40
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157280690 Original CRISPR GTCAGATTCTGGGAAGGTGA GGG Intronic
900203765 1:1422331-1422353 GTCAGGATCTGGGAAGGTGACGG - Intergenic
901104063 1:6741669-6741691 GTCAGAGTCTGAGAAGGAGATGG - Intergenic
901888191 1:12239091-12239113 GTAGGACTCTGGGAAGGTTATGG + Intronic
902406927 1:16189432-16189454 GTGGGATCCTGGGAAGGGGAAGG + Intergenic
903651534 1:24925476-24925498 ATGAGATTTTGGGAAGGTTAGGG - Intronic
903947500 1:26972828-26972850 GGCAGAATCTGGGAAAGAGAGGG + Intergenic
905283146 1:36861823-36861845 GTCAGGATCTGGGATGGGGAAGG + Intronic
905317659 1:37093832-37093854 GTTGGCTTCTGGGAAGGTGGAGG + Intergenic
906527326 1:46502424-46502446 GTCAGATTCTGGTATTTTGAAGG - Intergenic
909071137 1:70994890-70994912 TTCACATTCTTGGAAGCTGAAGG + Intronic
910116397 1:83736708-83736730 ATCACATTCTGGAAAGTTGAAGG + Intergenic
910592160 1:88937344-88937366 CTCAGGGACTGGGAAGGTGAGGG + Intronic
911090448 1:94013222-94013244 GTCAGACTCTGGAAAGGCGGGGG - Intronic
915028821 1:152858564-152858586 GTCAGATTCTGTGTAGGTGCTGG + Intergenic
915859622 1:159430305-159430327 GTCACAATCTGGGATGGAGATGG - Intergenic
916644521 1:166769952-166769974 TTCAGATCTTGGGAAGGTCATGG - Intergenic
918694735 1:187531233-187531255 GTCAGATTATTTGAAGGAGAAGG + Intergenic
919577022 1:199322900-199322922 GAAACATTCTTGGAAGGTGAGGG - Intergenic
920933043 1:210406817-210406839 GTCTCATTCTGGGGAAGTGAAGG + Intronic
922318855 1:224466746-224466768 GTCAAATTCTGGCAAGGATATGG - Intronic
922532258 1:226353447-226353469 GGCAGTTTCAGGGAAGGTGAAGG - Intergenic
922575191 1:226656389-226656411 TTCACATTCTGGGCAGGTGCGGG + Intronic
922787152 1:228288572-228288594 ATCAGATTCTGGGAAGCACAGGG - Intronic
924448068 1:244152417-244152439 GTCAGAACCAGGGAAGCTGATGG + Intergenic
924492606 1:244553832-244553854 ATTAGAGTCTGGGAAGGAGAGGG - Intronic
924603384 1:245510975-245510997 GTAAAATTGTGCGAAGGTGAAGG - Intronic
924690441 1:246344716-246344738 GTCAAGTGCTGGCAAGGTGATGG - Intronic
1063048445 10:2418262-2418284 GCCAGAGCCTGGGAAGGGGAGGG - Intergenic
1063313649 10:4981649-4981671 CTCAGAATCTGGGGATGTGATGG - Exonic
1064513157 10:16117140-16117162 GTCAGATTCTGGCAGCGTGAGGG + Intergenic
1064546728 10:16457713-16457735 GCCAGTTTCTGGGAAGGCTAAGG - Intronic
1064566224 10:16641670-16641692 GTCACATTCTGGGAAGGCAGGGG - Intronic
1065217250 10:23460913-23460935 GACAAATTGTGGGAAGGTGAAGG + Intergenic
1067063886 10:43092941-43092963 GTCAGAATTTGGGAAGGGGAAGG - Intronic
1068321765 10:55427111-55427133 GGGAGATTCTGGGAAGATGAGGG - Intronic
1068516142 10:58027753-58027775 GTCAGATTCCAAGCAGGTGAAGG - Intergenic
1068593627 10:58877008-58877030 GACAGAGTCTGGGAAGAGGAGGG - Intergenic
1069865250 10:71498359-71498381 GTCACATTCGGGCCAGGTGAAGG + Intronic
1070156988 10:73841296-73841318 GTCTTATTATGGGAAGGAGAAGG + Intronic
1070668874 10:78364187-78364209 GTCGCACTCTGGGAAGGTGTTGG - Intergenic
1071273618 10:84031740-84031762 GTCATATTCTGAGGTGGTGAGGG - Intergenic
1071769479 10:88709810-88709832 GTAAGATTCAGGAAAGGAGAGGG + Intergenic
1071893414 10:90037879-90037901 GTCAGAATCTGGAAAGGAGAAGG - Intergenic
1073510045 10:104037165-104037187 TTCAGATTCTGGAATAGTGAGGG - Intronic
1073589259 10:104740793-104740815 GTGAGATTCTGGGGATTTGAGGG + Intronic
1074777287 10:116775648-116775670 CTCGGATGCTGGGAAGGTGCTGG + Intergenic
1077795359 11:5485863-5485885 GTCACATTCTGAGATGCTGAGGG - Intronic
1079125154 11:17713852-17713874 TTCAGGTGCTGGGAATGTGATGG - Intergenic
1080442629 11:32308976-32308998 GTGGGATTCTGAGAAGGTGTGGG + Intergenic
1082986881 11:59176701-59176723 TTCAGCTTCTGGGAAGTGGAAGG - Intronic
1083168718 11:60908962-60908984 AACAAATTGTGGGAAGGTGAGGG + Intergenic
1083193996 11:61072176-61072198 GTCAGCTTCTGGGAAGAAGTGGG + Intergenic
1083815978 11:65132705-65132727 GTGAGATTCAGGGGAGGGGAAGG - Intronic
1083856522 11:65395869-65395891 GTCTGATTCTAGGCAGGTGGGGG + Intronic
1084106286 11:66982978-66983000 CCAGGATTCTGGGAAGGTGAAGG - Intergenic
1088053304 11:105544940-105544962 GGCAGGTGGTGGGAAGGTGAGGG + Intergenic
1088123126 11:106393266-106393288 GACAAATTTTGGGAAGGTAAGGG + Intergenic
1088424705 11:109690754-109690776 GTCAGGTTCTGGAGAGATGAAGG + Intergenic
1089141489 11:116288401-116288423 TTCTGATTCTGGGAAGGCCAAGG - Intergenic
1089756836 11:120693564-120693586 GTCAGATACTGGGAAAGTCCTGG + Intronic
1090088520 11:123672803-123672825 GGCAGATGGTGGGAAGGCGAGGG + Intergenic
1090289116 11:125526484-125526506 GGCAAATTTTTGGAAGGTGAGGG - Intergenic
1090455400 11:126844461-126844483 GGCAGATTTTGGGTAGGTGGTGG + Intronic
1090883422 11:130854786-130854808 GACAGAGACTGGGAAGGAGAAGG - Intergenic
1093497193 12:19771780-19771802 GTCTGGTACTGTGAAGGTGATGG + Intergenic
1093796556 12:23320254-23320276 GGCAGGTTGTGGGGAGGTGAGGG + Intergenic
1094408599 12:30146177-30146199 GTCAGACTCTGGAAAGGGCAAGG + Intergenic
1096185927 12:49580571-49580593 GTGAGTTCCTGGGAAGGTGCAGG - Intronic
1096187098 12:49588432-49588454 GGTAGGTTCTGGGAAGCTGAGGG - Exonic
1096476093 12:51910131-51910153 GTCTAATCCTGGGAATGTGATGG - Intronic
1096639142 12:52980339-52980361 GCCAGAGCCTCGGAAGGTGAGGG - Intergenic
1096884330 12:54701352-54701374 GTCAGAGTCAGAGAAGGAGATGG + Intergenic
1098217216 12:68233454-68233476 GTCACATTCTGAGAAGCCGAGGG - Intergenic
1099186776 12:79523590-79523612 GACAGAGTCTGGGAAGTGGAAGG + Intergenic
1099833262 12:87873180-87873202 GTTAGATTCTGAGAAGGATATGG - Intergenic
1101817407 12:108156148-108156170 GTCAGATGGTGAGAAGATGAAGG + Intronic
1102088030 12:110160043-110160065 GCGAGATTCTGAGAAGGTGGTGG - Intronic
1102732585 12:115125968-115125990 GTCAGATTTTGTGTTGGTGATGG + Intergenic
1105310098 13:19198900-19198922 CTTAGATGTTGGGAAGGTGAAGG + Intergenic
1105327676 13:19384640-19384662 GACAGGTTGTGGGAGGGTGAGGG + Intergenic
1105864225 13:24445038-24445060 GACAGGTTGTGGGAGGGTGAGGG - Intronic
1107673169 13:42767917-42767939 TTTAGCTTCTGGGAAGGTCAAGG + Intergenic
1107985342 13:45771047-45771069 GACAAGTTGTGGGAAGGTGAGGG + Intergenic
1108705350 13:52980500-52980522 GTCAGCTTTTGAGAAGATGAGGG + Intergenic
1109292231 13:60490748-60490770 GTCAGATTCTGGAATTTTGAAGG + Intronic
1110903825 13:80860657-80860679 GTAGGAGTGTGGGAAGGTGATGG - Intergenic
1113652229 13:112042141-112042163 GCCAGAGGCTGGGAAGGTCAAGG + Intergenic
1114636514 14:24190145-24190167 GTCAGAAACCAGGAAGGTGAAGG + Intronic
1115224163 14:31086090-31086112 TTCAGATTTTAGGAAGCTGATGG - Exonic
1116767382 14:49089108-49089130 GTCAGATAATGGAAAAGTGAAGG - Intergenic
1118754547 14:68830386-68830408 TTCAGAGGCTGGGAAGGAGAGGG - Intergenic
1119870306 14:78011458-78011480 TTTAGATTCTGGGAGGGTGGTGG + Intergenic
1121512913 14:94525942-94525964 GAGAGATTCTAGTAAGGTGAAGG - Intergenic
1124210974 15:27764729-27764751 ATCAGGTCCTGGGAAGGTGAAGG + Intronic
1126347079 15:47707570-47707592 GACAGAGTCTAGGAATGTGAAGG + Intronic
1126919732 15:53507676-53507698 GTATAATTCTAGGAAGGTGATGG + Intergenic
1128146350 15:65334403-65334425 GACAGATTCTGGGGTGCTGAGGG + Intronic
1128236861 15:66073546-66073568 GTTAGATCCTGGAAAGGAGATGG - Intronic
1131251577 15:90834270-90834292 GACAAGTTATGGGAAGGTGAGGG + Intergenic
1131257801 15:90873103-90873125 GTCAGAGTCTGGGATGGGGGTGG + Intronic
1131272598 15:90956348-90956370 GCCAGATGCTGGGAAGCTGCGGG + Intronic
1132571692 16:647048-647070 GTCAGAATCTGGGCTGCTGATGG + Intronic
1133640088 16:7708417-7708439 GCCAGGTTCTGGGAAGGGGGAGG - Intronic
1134110351 16:11511667-11511689 GCCAGGGTCTGGGAAGATGATGG + Intronic
1135284794 16:21184159-21184181 GACAAGTTATGGGAAGGTGAGGG + Intergenic
1135899587 16:26444590-26444612 GGCAGATTCAGGGAAGGTGGAGG + Intergenic
1136277321 16:29186700-29186722 GTCCCTTTCTGGGAAGGCGAGGG + Intergenic
1136359551 16:29769873-29769895 CTCAGATTCAGGGTAGGTAAGGG - Intergenic
1137247062 16:46714510-46714532 GTCAGCTGCTGGGCAGGGGAGGG - Intronic
1138309118 16:56008253-56008275 GGCACATTCTGGGCAGGTGGAGG - Intergenic
1139303474 16:65964139-65964161 GTAACAGTCTGGGAAGGTGAAGG - Intergenic
1139450756 16:67026789-67026811 GTCAGGTTTTGGGACGGTGGGGG + Intergenic
1139852556 16:69959831-69959853 GGCAGATACTGCCAAGGTGAGGG + Exonic
1139881527 16:70182739-70182761 GGCAGATACTGCCAAGGTGAGGG + Exonic
1140370982 16:74412766-74412788 GGCAGATACTGCCAAGGTGAGGG - Exonic
1141223983 16:82098029-82098051 GTCAGATCCTGGGAAGGCCAAGG - Intronic
1141688053 16:85581463-85581485 TTCGGATTCTGGGGAGCTGACGG + Intergenic
1142081699 16:88152744-88152766 GTCCCTTTCTGGGAAGGCGAGGG + Intergenic
1143109119 17:4543716-4543738 CTCAGGTGCTGGGGAGGTGAAGG - Intronic
1143370438 17:6435835-6435857 GGCAGATTCTGGGGAGGGGAGGG - Intergenic
1144670233 17:17128725-17128747 CCCAGCTTGTGGGAAGGTGAGGG - Intronic
1146151554 17:30477449-30477471 AGCAGTTACTGGGAAGGTGAGGG + Exonic
1146995949 17:37321249-37321271 GTCAGATTCTGGGAGGATCTGGG - Intronic
1147317096 17:39626294-39626316 GTCAGAGGCTGTCAAGGTGATGG - Intergenic
1147701731 17:42400409-42400431 CTCAGAATCAGGGAAGCTGACGG - Intergenic
1148985728 17:51619435-51619457 GTCAGACTCTGGGAATTTTAAGG - Intergenic
1149555085 17:57567833-57567855 AACAGATTATGGGAAGGGGAAGG + Intronic
1151980599 17:77506329-77506351 GTCAGAGTGGGGGTAGGTGAGGG + Intergenic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1152882004 17:82823025-82823047 GTCCGATTCTGAGAGGGGGAAGG + Intronic
1153086062 18:1289146-1289168 CTCAGATACTGGGAAGGTTGAGG + Intergenic
1153363811 18:4230621-4230643 GTCAGATGCTGGGAAGTGGAAGG + Intronic
1153420520 18:4899922-4899944 ATCAGATTCTGGGGAGATGAGGG - Intergenic
1154338256 18:13482742-13482764 GACAAGTTATGGGAAGGTGAGGG + Intronic
1156648875 18:39200575-39200597 GTCAGAGACTGGAAAAGTGAAGG + Intergenic
1157280690 18:46344727-46344749 GTCAGATTCTGGGAAGGTGAGGG + Intronic
1159183316 18:64939085-64939107 TTCAGACTCTGGGATGGTGATGG + Intergenic
1162829635 19:13276271-13276293 GACAGATTCTTGGAAGGTTCTGG - Intronic
1164895464 19:31873555-31873577 CTCTGACTCTGGGGAGGTGAAGG - Intergenic
1165269674 19:34695191-34695213 ATCAGAGGCTGGGAAGGGGAGGG + Intergenic
1165910037 19:39220053-39220075 GGCAGATTCTGAGCAGGGGAGGG + Intergenic
1166306943 19:41940513-41940535 GACAGATTCAGGAAAGGGGAGGG + Intergenic
1166543885 19:43622969-43622991 GTCAGTTTCTGGGAAGGGTGGGG - Exonic
1166681526 19:44770620-44770642 GTCAGAGTCTGGGGAGCTGGGGG + Intergenic
1167098062 19:47385991-47386013 GTCAGCTTCTGGGAGGAGGAAGG + Intergenic
1167406860 19:49316200-49316222 GTAAAATCCTGGGAAGGTAATGG + Intronic
1168012822 19:53547203-53547225 GTCAGGGCCTGGGAGGGTGATGG - Intronic
1168092654 19:54095865-54095887 GTCATCAGCTGGGAAGGTGAGGG - Exonic
1168332696 19:55579301-55579323 GGCCGGTTCTGGGAAGGTGCGGG + Exonic
1168378129 19:55898055-55898077 GCCAGGTGCTGGGAAGTTGAGGG - Intronic
928230071 2:29490517-29490539 GTCAGAGACTTGGGAGGTGATGG + Intronic
929322829 2:40566138-40566160 GTTCGATTCTGGGAAGGAGTGGG - Intronic
930752459 2:54946285-54946307 GCCAAGATCTGGGAAGGTGAGGG - Intronic
931796994 2:65720883-65720905 GACAGAGTTTAGGAAGGTGATGG + Intergenic
932941896 2:76176803-76176825 ATCAGATGCTGGGAAGGGGCAGG - Intergenic
933767372 2:85719292-85719314 GTCACTTACTGGGAGGGTGAGGG - Intergenic
933901935 2:86856294-86856316 TTCAGAGTCTGAGAAGGTGGAGG - Intronic
934664390 2:96159409-96159431 GTCAGAGTCTGGGACAGCGAGGG - Intergenic
935482601 2:103612019-103612041 GTGAGATACTGGGAAGCTTAAGG + Intergenic
935778608 2:106492971-106492993 TTCAGAGTCTGAGAAGGTGGAGG + Intergenic
936078176 2:109415021-109415043 GCCAGAGTCAGGGAAGGGGATGG + Intronic
936583416 2:113727566-113727588 GCCAGATTCTGGGCAGTCGAGGG - Intronic
937117407 2:119418068-119418090 GTCATATGGTGGGAAGGTAAGGG - Intergenic
937131280 2:119515722-119515744 CTCAGAATCAGGGAAGATGATGG - Intronic
940135407 2:150430048-150430070 GTCAGATCCTGGGAAGGGCATGG - Intergenic
941000216 2:160194966-160194988 GAAAGACTCTGGGAAAGTGAAGG + Intronic
942370314 2:175276721-175276743 GTCACATTCTGAGGTGGTGAGGG - Intergenic
945064107 2:205934017-205934039 GACAAATTATGGGAAGGTGAGGG - Intergenic
945265830 2:207890265-207890287 TTCAAATTATGGGAAGGAGATGG + Intronic
945319771 2:208407408-208407430 GTGTGAGGCTGGGAAGGTGAAGG + Intronic
945563325 2:211365322-211365344 CACAGATTATGGGAGGGTGAAGG - Intergenic
946278916 2:218651984-218652006 GCCAGATTCTGGGCAGGAGAAGG + Intronic
946977499 2:225169542-225169564 GGCAAATTCTTGGAAGGGGATGG + Intergenic
948290588 2:236821296-236821318 GAAAGATTCTGAGAAGGTGAGGG + Intergenic
1168911602 20:1452486-1452508 GTCAGAAACTGGGCAGGTAAGGG - Exonic
1169359492 20:4936167-4936189 TGCAGATTTTGGGAAGATGATGG - Intronic
1169456636 20:5758208-5758230 GTCAGATGCAGGGACAGTGAGGG + Intronic
1169475709 20:5929499-5929521 GTCATATTTTGGGATGGTGTGGG + Intergenic
1170310562 20:14986798-14986820 CTAAGATTCTGAGGAGGTGACGG - Intronic
1170894884 20:20403945-20403967 GACAGATGCTGGGATGGTGGAGG + Intronic
1171485777 20:25484428-25484450 GGCAGATTGTGGGCAGGTGCTGG + Intronic
1171564277 20:26164076-26164098 GTCAGCTACTTGGAATGTGACGG + Intergenic
1172192669 20:33071296-33071318 GTAAGTTCCTGGGAGGGTGAGGG + Intronic
1175148915 20:56917588-56917610 GGCAGATTGTGGGAAGAGGACGG - Intergenic
1175703972 20:61162058-61162080 GTCAAGTTCAGGGAAGGTGGGGG - Intergenic
1176897439 21:14397938-14397960 GCCAGAATCAGGGAAGGTGAAGG + Intergenic
1177441195 21:21127614-21127636 ATCAGAGGCTGAGAAGGTGAGGG - Intronic
1178144869 21:29727835-29727857 ATCAGATTATGGGCAGATGATGG - Intronic
1179103780 21:38380208-38380230 CTCAGGAGCTGGGAAGGTGATGG - Exonic
1179140293 21:38719323-38719345 GGGAGAATCTGGGAAGCTGATGG + Intergenic
1180160126 21:45995411-45995433 GGCAGATTGTGGGGAGGGGACGG + Intronic
1181128815 22:20717526-20717548 GGCAGATTCTGGGGAGGGGCTGG + Intronic
1183003362 22:34879944-34879966 GGGAGTTTCTGGGATGGTGATGG - Intergenic
1183184187 22:36282443-36282465 ATCAGATTCTGAGCAGGGGAGGG + Exonic
1184048728 22:41988735-41988757 GTCAGATTGTGGGAAGGGCAAGG + Intronic
949615356 3:5747911-5747933 GTCAGATGCTGGGAATAAGATGG - Intergenic
950112370 3:10427643-10427665 GACACAGTCTGGGATGGTGAAGG + Intronic
950841307 3:15970609-15970631 GTCAACATCTGGGAAGGGGAAGG - Intergenic
951777490 3:26325765-26325787 TTCAGACCCTGGGAAGGAGAAGG + Intergenic
952050174 3:29375701-29375723 AACAGATTCTGGCAAGGTTATGG + Intronic
952505230 3:34001143-34001165 GTCAGAGTGTGTGGAGGTGAGGG + Intergenic
957228451 3:77479168-77479190 GACAAGTTCTGGGAAGGTGAGGG + Intronic
957699597 3:83691268-83691290 GTCAGAGTCGGGGGAGCTGAAGG + Intergenic
958438131 3:94122775-94122797 GTAAGATACTGGGAAGTAGAAGG - Intronic
959007037 3:101031149-101031171 GTCAAAGTCTGGGAAGGGAAGGG + Intergenic
960597974 3:119423988-119424010 TACAGAGGCTGGGAAGGTGATGG - Intergenic
961516892 3:127443652-127443674 GTGTGAGTCTGGGAAGGCGAGGG + Intergenic
962013652 3:131419017-131419039 ATGAGAATCTGGGCAGGTGATGG - Intergenic
963283726 3:143412590-143412612 GTCAGAGACAGGGAAAGTGATGG - Intronic
963886127 3:150585142-150585164 GTCAGATACTTGGAAGGAGGAGG - Intronic
963972655 3:151446702-151446724 GTCAGCTTTGGGGAAGGTGATGG + Exonic
965956979 3:174382464-174382486 GATAAATTATGGGAAGGTGAGGG - Intergenic
966593625 3:181706990-181707012 GTCAGATTTTGGAAGTGTGAAGG - Intergenic
968282758 3:197489519-197489541 GTCAGAGTATGGGAAGGTCAGGG - Intergenic
968543497 4:1181485-1181507 GGAAGATTCTGGGAAGATGGTGG + Intronic
968554209 4:1239105-1239127 ATCTGGTTCTGGGAAGGTCAGGG - Intronic
968797377 4:2716467-2716489 ATCAGATTCTGGGAAGGGGCCGG + Intronic
968894846 4:3393445-3393467 GTCAGAATCGGGGAAGGCCAGGG - Intronic
969342738 4:6552569-6552591 GTCAGAATCAGAGAAGGAGATGG - Intronic
969479663 4:7441211-7441233 GGCTGCTTCTGGGAAGGTGGAGG + Intronic
970718154 4:18952798-18952820 GATAAATTCTGTGAAGGTGAGGG + Intergenic
970806291 4:20038069-20038091 CTCACATGCTGGGAGGGTGAGGG - Intergenic
972800746 4:42473538-42473560 GTCAGACACTGGGAATGGGAAGG - Intronic
972949039 4:44295471-44295493 GTCAGTTTCTGGGAAAGGGAGGG + Intronic
973878858 4:55248641-55248663 GACAGATTCTGGGGAGGTCAGGG + Intergenic
974178939 4:58360318-58360340 GTCAGACTCTGGGTAGATGATGG - Intergenic
975225456 4:71866156-71866178 GTAACATTCTGAGAAGGGGATGG + Intergenic
976412797 4:84735725-84735747 CTTAGATTCTGGGATGGTGAAGG + Intronic
976914004 4:90347548-90347570 TTCACGTTCTGGGAAGGTCAGGG - Intronic
977299335 4:95250088-95250110 GTCAGCTTCTAGGAAAGCGAAGG - Intronic
977494694 4:97760287-97760309 GCTAGATTCTGGGAAGGGTATGG - Intronic
978370922 4:108029058-108029080 AGCAGATTCTGAGAAGGTGGTGG - Intronic
979018359 4:115463757-115463779 TTCAAACTCTGGGAAGATGAGGG + Intergenic
980070115 4:128234900-128234922 GTAAGATTCTGGGAAGGAGACGG + Intergenic
984716886 4:182934139-182934161 ATCTGATGGTGGGAAGGTGAGGG - Intergenic
985328139 4:188796006-188796028 GTCAGCAGCTGGGAAGGTGAAGG - Intergenic
986019687 5:3789922-3789944 GGCATTTTCTGGGACGGTGACGG + Intergenic
986234145 5:5892200-5892222 GTCACATTCTGGGAGGATGGTGG - Intergenic
986258242 5:6119999-6120021 GTGTGATTCTGGGAAGGTATAGG - Intergenic
986573488 5:9189226-9189248 GTAAGATGCCAGGAAGGTGACGG - Intronic
986983714 5:13477208-13477230 GTGAGCTTCTGAGGAGGTGATGG - Intergenic
986998297 5:13632643-13632665 GTCAGATATTGGGAAGGAGTAGG + Intergenic
988621918 5:32831892-32831914 CTCATATCCTGGGGAGGTGAAGG + Intergenic
990089510 5:52024479-52024501 CTCAGAGTCAGGGAAGCTGATGG + Intronic
990953437 5:61320613-61320635 GGCAGAAGCTGGGAAGGGGAAGG + Intergenic
991412434 5:66358242-66358264 GTCATATTCTGAGAAAGTGTGGG + Intergenic
992456635 5:76922443-76922465 GAGACATTATGGGAAGGTGATGG - Intergenic
994340342 5:98619352-98619374 ACCAGAAGCTGGGAAGGTGAGGG + Intergenic
995425929 5:112022764-112022786 GACAGATTATGGGAATCTGAAGG - Intergenic
995736099 5:115300867-115300889 GTCACATTTTGGTAATGTGACGG + Intergenic
995833167 5:116375940-116375962 GTCAGGTTCTGAGAGGCTGACGG + Intronic
997488671 5:134254048-134254070 GGGAGATTTTTGGAAGGTGATGG - Intergenic
998435025 5:142100855-142100877 GACAAGTTATGGGAAGGTGAGGG - Intergenic
998797253 5:145833735-145833757 GGGAGATGCTGGGAAGATGAAGG - Intronic
999652069 5:153777398-153777420 GTCAAACTCTGGCAAGGTAACGG - Intronic
999818925 5:155204919-155204941 GAAGGATTCTGGGAAGCTGATGG + Intergenic
1000020748 5:157317146-157317168 ATAAGGTTGTGGGAAGGTGAAGG - Intronic
1001459300 5:171895497-171895519 GACAGACACTGGGAAGATGATGG - Intronic
1001952723 5:175827389-175827411 GTCAGATGCTGGAAAGAAGAGGG - Intronic
1002279286 5:178121294-178121316 GTCAGCCTCTGGGAGGGTGCCGG - Exonic
1003103153 6:3193039-3193061 TTCAGATTATAAGAAGGTGATGG - Intergenic
1003265594 6:4562616-4562638 GTCACATTCTGGGAAATTGGAGG - Intergenic
1005777382 6:29149956-29149978 AACAGATGCTGGGAAGGTTATGG - Intergenic
1006211011 6:32394875-32394897 GTCAGGGCCTGGGAAGATGATGG + Exonic
1006590240 6:35149693-35149715 ATCAGATTCTGAGAAGATGAAGG + Intergenic
1007558323 6:42784089-42784111 GTCAGATTACGGGAAGGTGATGG + Intronic
1007855676 6:44853756-44853778 GGCAAATTATGGGAAGGTGAGGG + Intronic
1008628459 6:53341298-53341320 GTTACATTCTGGGAGGCTGACGG - Intronic
1008909246 6:56715772-56715794 GGAAGCTGCTGGGAAGGTGAGGG - Intronic
1011382274 6:86755404-86755426 ATCATGTTTTGGGAAGGTGAAGG - Intergenic
1015001872 6:128227335-128227357 GAGGGATTCTGGGAAGCTGATGG + Intronic
1016575717 6:145567814-145567836 GTCAGACTCTGAGAGAGTGATGG - Intronic
1017236368 6:152120839-152120861 GGCAGTTTCAGGCAAGGTGAAGG + Intronic
1018215824 6:161526941-161526963 GACAGGTTATGGAAAGGTGAGGG + Intronic
1018367000 6:163130886-163130908 CTGAGATTCTGGGAAGGACATGG - Intronic
1018978429 6:168582997-168583019 GGCAGCCTCTGTGAAGGTGACGG - Intronic
1022889697 7:34683608-34683630 GCCAGGGTCTGGGAAGGTGCTGG + Intronic
1023699230 7:42876054-42876076 ATAGGATTCTGGGAAGGTAAAGG + Intergenic
1024338751 7:48236185-48236207 GGCAAGTTATGGGAAGGTGAGGG + Intronic
1025261446 7:57421726-57421748 GTCAGCTACTGGGGAGGTGGAGG + Intergenic
1025738772 7:64178921-64178943 GTCAGCTACTGGGGAGGTGGAGG + Intronic
1025873850 7:65461469-65461491 GTAAGAGTTTGGGAAGGGGAAGG + Intergenic
1027708988 7:81573298-81573320 GCCAGAATCTGAGAAGGAGAAGG - Intergenic
1027904840 7:84166158-84166180 CTCAGATTCTGGGGAGGTTGAGG + Intronic
1028272894 7:88815627-88815649 GTCAGAGCCTGAGAAGGTGAAGG - Intronic
1028893337 7:96013162-96013184 GTCAGACTCAGAGAAGGAGATGG + Intronic
1030131016 7:106200416-106200438 GTCAAAGTCTTGGAAGGTGTGGG + Intergenic
1031199918 7:118668956-118668978 CTCAGAATCAGGGAAGCTGATGG - Intergenic
1036615934 8:10387596-10387618 GGTGGATTGTGGGAAGGTGAGGG + Intronic
1037522397 8:19692815-19692837 GCCAGATTCTGGGGAGGTTAAGG - Intronic
1037579557 8:20236482-20236504 GCCAGAGTCTGGGCTGGTGAGGG - Intergenic
1038431722 8:27505669-27505691 GTCAGCTTGTGGGGAGGTGGGGG - Intronic
1039005665 8:33034124-33034146 GTCAGAAGCTTGGAAGGGGAGGG + Intergenic
1041118829 8:54566146-54566168 GTCACATTCTGAGGAGCTGAGGG + Intergenic
1041860789 8:62510499-62510521 GTCAATCGCTGGGAAGGTGATGG + Intronic
1042236137 8:66614536-66614558 TATAGATTCTGGGAAGGTAAGGG + Intergenic
1042917621 8:73890739-73890761 GACAAATTATGGGAGGGTGATGG + Intergenic
1043928030 8:86060163-86060185 GACAGGTTCTGGGAGGGGGAGGG - Intronic
1044855810 8:96474415-96474437 GTCAGATTATAGGAATGGGAAGG - Intergenic
1046437517 8:114211207-114211229 GTGAGACTATGCGAAGGTGATGG - Intergenic
1047296029 8:123571202-123571224 GGCTGATTCAGGGATGGTGAGGG - Intergenic
1047806772 8:128369254-128369276 GTGAGTGTCAGGGAAGGTGAAGG + Intergenic
1047847136 8:128818803-128818825 CTGATATTCTGGGAAGGGGATGG + Intergenic
1050087382 9:1980177-1980199 ATCAGATTCTGGAAAGGGGAGGG - Intergenic
1050714889 9:8511565-8511587 GTGAGATTCTGGGAAAATCATGG + Intronic
1052087621 9:24286931-24286953 GTCAGGGTCTGCCAAGGTGAAGG - Intergenic
1053539775 9:38961672-38961694 GACAAGTTATGGGAAGGTGAGGG + Intergenic
1054626366 9:67402246-67402268 GACAAGTTATGGGAAGGTGAGGG - Intergenic
1056227780 9:84513073-84513095 GGCAGTGTCTGGGAAGTTGAGGG + Intergenic
1057522573 9:95771921-95771943 TTCCTATTCAGGGAAGGTGAGGG + Intergenic
1058735507 9:107890414-107890436 GTCACATTCTGAGAAACTGAGGG - Intergenic
1059717832 9:116930253-116930275 TGCAGTTTCTTGGAAGGTGATGG + Intronic
1062130707 9:134891628-134891650 ATCAGATTCTGGAGAGGTGAAGG - Intergenic
1062623572 9:137433351-137433373 GACAGAGACTGGGCAGGTGAGGG - Intronic
1186456568 X:9714479-9714501 GTCTGACCCTGGGAAGGAGACGG + Intronic
1187362713 X:18643076-18643098 GGAAGATTCTGGAAAGGGGAGGG + Intronic
1187421590 X:19139033-19139055 GTCAGATACTGCGGAGGTGCTGG + Intergenic
1188356842 X:29202358-29202380 AACAGATTCTGGCAAGGTTATGG + Intronic
1189195471 X:39148656-39148678 GTCTGCTTCTTGGAAGCTGAGGG - Intergenic
1189635526 X:43004461-43004483 GGCAGATTATGAGAAGGTGAAGG + Intergenic
1189944598 X:46165128-46165150 GACAGATCCTGGGTAGGAGAGGG + Intergenic
1190126508 X:47710220-47710242 GGAGGATTCTGGGAAGGTGGTGG - Intergenic
1190127693 X:47721545-47721567 GTAAGAGTCTGGGAAGGGGGTGG + Intergenic
1192728379 X:73776980-73777002 ATCAGATTCTAAGAAGGTGGGGG - Intergenic
1193177913 X:78416505-78416527 GCCAGAGCCTGGGAATGTGAGGG - Intergenic
1193542008 X:82783438-82783460 GGCAAATTATGAGAAGGTGAGGG - Intergenic
1193919095 X:87404373-87404395 GTTAGAAACTGGGAAGGTAAAGG - Intergenic
1193991128 X:88308610-88308632 GACAGATGCTGGGAAGGTTATGG - Intergenic
1196247978 X:113423439-113423461 GACAAATTATGGGAGGGTGAGGG - Intergenic
1196337660 X:114557609-114557631 GGGTGATTCTGGGAAGATGATGG + Intergenic
1197236400 X:124070110-124070132 GACACATTCTGGGAAGCTGTTGG - Intronic
1197439029 X:126468053-126468075 GTCAGACTCTGGGAGGTAGAAGG + Intergenic
1198311651 X:135430656-135430678 GGAAGATTCTGGGAAGGTGGTGG + Intergenic
1200060028 X:153480057-153480079 GACAGCTTCTGGGGAGATGAAGG - Intronic