ID: 1157280895

View in Genome Browser
Species Human (GRCh38)
Location 18:46345600-46345622
Sequence CTTGACTCCTAGGGCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157280895 Original CRISPR CTTGACTCCTAGGGCAAAAC AGG Intronic
900265130 1:1753452-1753474 CTTGTCCCCTAGGGCACCACAGG - Intronic
900735092 1:4294711-4294733 CTTGACTCCTAGGTCTAAGGGGG - Intergenic
900752865 1:4410057-4410079 CTTAATTCCTAGGGCATGACTGG + Intergenic
904939567 1:34155982-34156004 CCTGACTCCTAGGCCAAACAAGG + Intronic
905366864 1:37456907-37456929 CCTGGCTCCAAGGGCAGAACTGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908682849 1:66682032-66682054 GTTGACTCCAAGGGAAAAAGTGG + Exonic
912675395 1:111675644-111675666 CTTGACACCTAGTACAGAACTGG + Intronic
915133470 1:153712704-153712726 CTTAACTCCTATATCAAAACTGG + Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917949492 1:180015837-180015859 CTTTTCTCCTAGGCCAAACCAGG + Exonic
920826834 1:209430587-209430609 CTTAACTCCAAGAGCAAAAGGGG - Intergenic
921959803 1:221022710-221022732 CTGGCATCCTAGGGTAAAACAGG - Intergenic
1067192247 10:44081557-44081579 CTTGACTGCTTGGGGACAACAGG + Intergenic
1067747363 10:48945978-48946000 CGTGGCTCCTAGGGCACAAGCGG + Intronic
1074539357 10:114351763-114351785 CTTGACTCTTAGGGCACTTCCGG - Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1079396083 11:20064885-20064907 CCTGATGCCAAGGGCAAAACTGG - Intronic
1082023489 11:47553593-47553615 CTTGTCTGCTGGGGCAAAAAGGG - Intronic
1087146391 11:94816696-94816718 TTTGACTTCTGGGGCTAAACAGG + Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1092655956 12:10685883-10685905 CCTGACTCCTAAGGCAAAATGGG - Intergenic
1093415144 12:18911298-18911320 TTTGACTCCCTGGGCAAAGCTGG + Intergenic
1094876266 12:34646849-34646871 ATTGAGTCCTATGGCAAAAAAGG + Intergenic
1094876993 12:34659444-34659466 ATTGAGTCCTATGGCAAAAAAGG + Intergenic
1095069904 12:37828791-37828813 CTTGAGGCCTATGGCAAAAAAGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098296366 12:69008173-69008195 CTACACTCCCAGGACAAAACAGG - Intergenic
1098666236 12:73166927-73166949 TTTGACTCCTAGGTCTAAAAAGG + Intergenic
1099130392 12:78821999-78822021 CTTAACTCATTGGCCAAAACTGG - Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1102036973 12:109776243-109776265 CTTGTCTCATGGGGCAAAACTGG + Intergenic
1102782942 12:115581270-115581292 CTTGACTACTAGTCCAAAAGTGG - Intergenic
1105080659 13:16112420-16112442 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105080899 13:16115847-16115869 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105081123 13:16119275-16119297 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105081326 13:16122699-16122721 CTTGATTCTTATGGCAAAATAGG + Intergenic
1105081555 13:16126124-16126146 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105081787 13:16129552-16129574 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105082008 13:16132980-16133002 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105082234 13:16136405-16136427 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105082469 13:16139831-16139853 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105082692 13:16143255-16143277 CTTGTTTCCTATGGCAAAATAGG + Intergenic
1105082921 13:16146683-16146705 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105083149 13:16150109-16150131 CCTGATTCCTATGGCAAAATAGG + Intergenic
1105083603 13:16156961-16156983 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105083830 13:16160386-16160408 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105084051 13:16163812-16163834 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105084142 13:16165629-16165651 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105084349 13:16169056-16169078 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105084723 13:16175908-16175930 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105084910 13:16179331-16179353 ATTGATTCCTATGGCAAAATAGG + Intergenic
1105085104 13:16182755-16182777 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105085489 13:16189605-16189627 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105085685 13:16193028-16193050 CTTGATTCTTATGGCAAAATAGG + Intergenic
1105085882 13:16196457-16196479 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105086072 13:16199881-16199903 CGTGATTCCTATGGCAAAATAGG + Intergenic
1105086272 13:16203306-16203328 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105086475 13:16206731-16206753 ATTGATTCCTATGGCAAAATAGG + Intergenic
1105086667 13:16210157-16210179 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105086860 13:16213582-16213604 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105087055 13:16217008-16217030 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105087249 13:16220430-16220452 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105087446 13:16223856-16223878 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105087648 13:16227280-16227302 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105091928 13:16304138-16304160 CTTGACGCCTACGGTAAAAAGGG + Intergenic
1105096982 13:16387377-16387399 CTTGACTCCTACGGTGAAAAGGG + Intergenic
1105103879 13:16500101-16500123 CTTGACACCTACGGTAAAAAGGG + Intergenic
1105104548 13:16511019-16511041 CTTGACACCTACGGTAAAAAGGG + Intergenic
1105123084 13:16813593-16813615 CTTGACTCCTACGGTGAAAAGGG + Intergenic
1105125916 13:16859802-16859824 CTTGACACCTACGGTAAAAAGGG + Intergenic
1105131663 13:16953942-16953964 CTTGACACCTACGGTAAAAAGGG + Intergenic
1105151361 13:17275271-17275293 CTTGACGCCTACGGTAAAAAGGG + Intergenic
1105155776 13:17347604-17347626 CTTGACGCCTAGGGTGAAAAGGG + Intergenic
1105171176 13:17593315-17593337 CTTGACGCCTACGGCGAAAAAGG + Intergenic
1107281812 13:38744980-38745002 TTTGACTTCTAGTGCAAAACAGG - Intronic
1110049900 13:70883730-70883752 CCTGACTCCTTGGTAAAAACAGG + Intergenic
1110110912 13:71744866-71744888 TTTGACTCCCAAGACAAAACTGG - Intronic
1114452232 14:22834946-22834968 CTTGACTGCCTGGCCAAAACTGG - Exonic
1115244081 14:31277144-31277166 TTTGACTCCTAGGTCTAAAAAGG + Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1119509158 14:75197633-75197655 CTTCACTCCTACATCAAAACAGG + Intergenic
1123175557 14:106414384-106414406 TTTGACTCCTAGGTCTAAAAAGG - Intergenic
1124240097 15:28021405-28021427 CCTGAAACCTAGAGCAAAACAGG + Intronic
1125533139 15:40427003-40427025 CGTGTCTTCCAGGGCAAAACTGG - Intronic
1125675001 15:41497134-41497156 CCTCACTCCTAGGGCTGAACAGG - Intronic
1126181448 15:45788796-45788818 ACTGACTCCTAGGGCCAGACTGG - Intergenic
1131918826 15:97301235-97301257 CTTGCATCTTAGGGAAAAACTGG - Intergenic
1135763017 16:25152790-25152812 ATTGACTGCCAGGGCCAAACAGG - Intronic
1144346116 17:14351322-14351344 CTTGACTTCTAGGGCTCAAGTGG - Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1150030575 17:61730162-61730184 CTTTAATCCTAGGGAAAAACAGG + Intronic
1157280895 18:46345600-46345622 CTTGACTCCTAGGGCAAAACAGG + Intronic
1163362015 19:16852732-16852754 CTTGGCTCTCAGGACAAAACAGG + Intronic
1164754310 19:30678635-30678657 CTGGACTCCTAGAGCCAAGCAGG + Intronic
1166412723 19:42567088-42567110 CTTAACTCCTGGGGTAAAAGAGG - Intergenic
932534293 2:72576007-72576029 CTGGCCTACTAAGGCAAAACTGG - Intronic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
937928658 2:127187944-127187966 CCTGCCTCCCAGGGTAAAACTGG + Intronic
937928789 2:127188707-127188729 CCTGCCTCCCAGGGTAAAACTGG + Intronic
940551633 2:155165760-155165782 TTTGACTCCTAAGGCACAAGTGG + Intergenic
940738410 2:157479797-157479819 GGTGAGTCCTAGGGCTAAACTGG + Intronic
942762984 2:179422172-179422194 CTTGTCTCTAAGGGCAAAAAAGG - Intergenic
947617603 2:231568508-231568530 CTTGTCTTCCAGGACAAAACAGG - Intergenic
948092386 2:235305383-235305405 CTTGTCTTCTTGGGCAAAAGGGG + Intergenic
948982074 2:241499502-241499524 CTGGCCTCCTAGGGCACAGCAGG + Intronic
1171506387 20:25638657-25638679 CTTGACTCCTGGGTCTAAAAAGG - Intergenic
1171733958 20:28747068-28747090 CTTGATTCCTATGGCAAAATAGG + Intergenic
1171742154 20:28910109-28910131 ATTGATTCCTATGGCAAAATAGG + Intergenic
1174022240 20:47540127-47540149 CTTGACTCCTAAGGCAATGTAGG - Intronic
1177279453 21:18961894-18961916 CATGCCTCCTAGGACAGAACAGG - Intergenic
1180163598 21:46009025-46009047 CTTGACTCCTAGGTCAGAGCAGG + Intergenic
1181646808 22:24235813-24235835 CTTGGCTTCCAGGGCAAAATGGG + Intronic
1185107175 22:48880037-48880059 CTGGAGTTCAAGGGCAAAACTGG - Intergenic
949877814 3:8638021-8638043 CGTGACTCCGAGGGCCAAATCGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951090922 3:18573252-18573274 CTTGTCTTCAAGGGCAGAACTGG - Intergenic
953117865 3:40010504-40010526 CTTGATTCCAAGAGCAGAACAGG + Intronic
964074483 3:152676689-152676711 GTTGACTCTTAGTGCACAACTGG - Intergenic
965465230 3:169021286-169021308 TTTAAGTCCTAGGGGAAAACTGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967220104 3:187241524-187241546 CCAGACTCCTTGGGCAGAACAGG + Exonic
967792136 3:193561056-193561078 CTTCACTCCTAGGAAAAATCTGG + Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
972254407 4:37337628-37337650 CTTGTCTCCTTGGGCAGCACAGG + Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
974374610 4:61060720-61060742 CTTGCCTCCCAGGGTTAAACAGG - Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
980092515 4:128457174-128457196 CTTGAATCCCAGGGGAAATCTGG - Intergenic
984499512 4:180541434-180541456 ATTGACTCTTAGGGGAAAGCAGG - Intergenic
986789298 5:11144509-11144531 CTTGTCTCCTGGGGCACAAAGGG + Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
992511742 5:77443445-77443467 CTTGACTCCAAGGCCATAATAGG + Intronic
992974170 5:82095815-82095837 CTTTACTCCTAGGGATAAGCTGG + Intronic
1006629227 6:35419253-35419275 CCTGACTCCTAGCCCAAAGCTGG - Intronic
1010399196 6:75429017-75429039 ATTGACTCTTAGGGCTAAAGAGG - Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1016313633 6:142761252-142761274 TTTGACTCCGAGGGCAAAAAAGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018290782 6:162290748-162290770 CTGGACTGTTAGGGCAGAACTGG - Intronic
1019414077 7:919434-919456 CGTCACTCAGAGGGCAAAACAGG + Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1028005568 7:85562178-85562200 CTTGACTCATTGGTGAAAACTGG - Intergenic
1028842635 7:95444385-95444407 CTTTCATCCTAGGGCAAAACTGG - Intergenic
1030361756 7:108602616-108602638 TTTGACTTCTAGGGCACAAATGG + Intergenic
1031302786 7:120084339-120084361 CTTGACTGCAAGTGGAAAACTGG + Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1038572859 8:28678018-28678040 CTTGGATCCAAGGCCAAAACAGG + Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1045026918 8:98096497-98096519 TTTGAATCTGAGGGCAAAACCGG - Intergenic
1047448536 8:124941741-124941763 CTTGTCTCCAAGGGCTAGACAGG + Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056343473 9:85664147-85664169 CATGACTGCTAGGGCCAAAGGGG + Intronic
1056390726 9:86139062-86139084 CATTACTCCTAGGGGAATACAGG + Intergenic
1203402742 Un_KI270519v1:128840-128862 ATTGATTCCTATGGCAAAATAGG - Intergenic
1189147871 X:38673754-38673776 CCTCACTCCTATGGTAAAACAGG + Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191175623 X:57498154-57498176 CTTGACCCCTTGGACAAAATAGG + Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1201550773 Y:15214358-15214380 CTGGACTCCTAGGGCAATCCAGG - Intergenic