ID: 1157281468

View in Genome Browser
Species Human (GRCh38)
Location 18:46348964-46348986
Sequence GCTCCATGCAACCAAGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157281468_1157281474 8 Left 1157281468 18:46348964-46348986 CCTTGAACTTGGTTGCATGGAGC 0: 1
1: 0
2: 2
3: 8
4: 110
Right 1157281474 18:46348995-46349017 GGAATGCTAGCCTGGGAACTGGG 0: 1
1: 0
2: 1
3: 20
4: 152
1157281468_1157281471 0 Left 1157281468 18:46348964-46348986 CCTTGAACTTGGTTGCATGGAGC 0: 1
1: 0
2: 2
3: 8
4: 110
Right 1157281471 18:46348987-46349009 ACAGTTTGGGAATGCTAGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 199
1157281468_1157281472 1 Left 1157281468 18:46348964-46348986 CCTTGAACTTGGTTGCATGGAGC 0: 1
1: 0
2: 2
3: 8
4: 110
Right 1157281472 18:46348988-46349010 CAGTTTGGGAATGCTAGCCTGGG 0: 1
1: 1
2: 0
3: 10
4: 114
1157281468_1157281476 27 Left 1157281468 18:46348964-46348986 CCTTGAACTTGGTTGCATGGAGC 0: 1
1: 0
2: 2
3: 8
4: 110
Right 1157281476 18:46349014-46349036 TGGGTCATCTAGCTCAAGACTGG 0: 1
1: 0
2: 1
3: 5
4: 70
1157281468_1157281473 7 Left 1157281468 18:46348964-46348986 CCTTGAACTTGGTTGCATGGAGC 0: 1
1: 0
2: 2
3: 8
4: 110
Right 1157281473 18:46348994-46349016 GGGAATGCTAGCCTGGGAACTGG 0: 1
1: 0
2: 1
3: 14
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157281468 Original CRISPR GCTCCATGCAACCAAGTTCA AGG (reversed) Intronic
900551130 1:3256189-3256211 GCTCCATGCCTCCAACTCCATGG + Intronic
901758171 1:11454001-11454023 GCTCCATGCCGCCTAGCTCACGG + Intergenic
902375791 1:16029369-16029391 GCTCCATGCCACCAGGTGCAGGG - Intronic
904638341 1:31902254-31902276 CCTACATGCAACCAAAATCAAGG + Intergenic
909041180 1:70654131-70654153 GCACCATGTAACTAAGTTCTGGG - Intergenic
910948942 1:92623965-92623987 GACCCATTCAACAAAGTTCAAGG - Intronic
911096353 1:94058263-94058285 GCTCCATAAAAGCAAGTCCATGG + Intronic
912689604 1:111794541-111794563 GCTCTAGGAAGCCAAGTTCAGGG - Intronic
917755707 1:178095018-178095040 ACTCCATGAAACCAAGTGAATGG + Intronic
921353744 1:214264568-214264590 GCTCTATGAAACCCAGTTAAAGG - Intergenic
1062945245 10:1456433-1456455 GCTCCATACAAGCCAGTTCTTGG + Intronic
1067553576 10:47252559-47252581 GCTGCAAGCAAAGAAGTTCAAGG + Intergenic
1069629035 10:69886598-69886620 GCTCCTTTCTACCATGTTCAAGG - Intronic
1072468270 10:95687666-95687688 GGTCAATGCAACCAACTTCCAGG - Exonic
1072991119 10:100194939-100194961 ATTCCAAGCAACCTAGTTCAAGG - Intronic
1074199969 10:111225794-111225816 GCTTTATGCATCCAAGTTCTGGG + Intergenic
1075813980 10:125250200-125250222 GCTCCAGGCATCCAGGCTCATGG + Intergenic
1079325530 11:19487924-19487946 GCTCCAAGCCACAAAGTTTAGGG + Intronic
1081368990 11:42274784-42274806 CCTCCATGCATTCAAGTTCCAGG + Intergenic
1083301386 11:61741197-61741219 GCTCTCTGCAGCCAAGGTCATGG + Exonic
1084368960 11:68725389-68725411 GCTCACTGCAACCTAGATCAAGG - Intronic
1087419188 11:97898786-97898808 CTTCCATGCAAACCAGTTCAGGG + Intergenic
1088480359 11:110291262-110291284 GCTCCATGCCACGAACTCCAGGG - Intronic
1088952242 11:114583669-114583691 GCACCATGCAAAGAAGTTCAAGG + Intronic
1089021672 11:115221957-115221979 GCTCAATGCAACTAGGTCCAGGG + Intronic
1095915531 12:47474558-47474580 GATCCATGCAACCAGGCTAAGGG + Intergenic
1098026557 12:66209548-66209570 TATACATGCAACAAAGTTCAAGG - Intronic
1100842322 12:98625412-98625434 AATCCACACAACCAAGTTCATGG - Exonic
1101542200 12:105675462-105675484 TTTCCATGGAACCAAGTTTATGG + Intergenic
1108578288 13:51807654-51807676 TCTCCATGTAGCCAAGTTGATGG + Intergenic
1111499500 13:89097905-89097927 GCTCGATGAAAGCCAGTTCAGGG - Intergenic
1120715984 14:87841091-87841113 TGTCCATGAAACAAAGTTCAGGG + Intronic
1125842358 15:42815488-42815510 ACTCCATGCAAAAAAGTTAAAGG + Intronic
1131566104 15:93486914-93486936 GCTACAGCCAAGCAAGTTCAGGG - Intergenic
1131578172 15:93613220-93613242 GCCCCATTCAGCCAAGTTGAAGG - Intergenic
1131702738 15:94957118-94957140 GCTCCATGCAACCAGGGTCATGG - Intergenic
1132203573 15:99971331-99971353 GCTCCCTGCAGCCAAGTCCCTGG + Intergenic
1133969160 16:10554769-10554791 GCTCCAGGGAACCGTGTTCAGGG - Intronic
1137027225 16:35489089-35489111 GCTCCAGGCAACCCATGTCAGGG + Intergenic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1144389919 17:14784132-14784154 GCTGCATGTAAGCATGTTCAGGG + Intergenic
1148962639 17:51406250-51406272 TCTCCCTGGACCCAAGTTCAGGG - Intergenic
1154310897 18:13265541-13265563 GCTCCATGCACCCAGGAGCAAGG + Intronic
1155163176 18:23211871-23211893 GCTCCATGCAGGCAAGCCCAAGG + Intronic
1155559421 18:27059996-27060018 ACTCCATTCAACCAAGTTTATGG - Intronic
1157281468 18:46348964-46348986 GCTCCATGCAACCAAGTTCAAGG - Intronic
1163022931 19:14493182-14493204 GCAGCATGCAATTAAGTTCATGG - Intronic
927315284 2:21674553-21674575 GGTCCATGCAAGCAAGTTTCAGG - Intergenic
931152134 2:59585926-59585948 GCTCAGAGGAACCAAGTTCAAGG + Intergenic
931777981 2:65556375-65556397 ACTCCATCCACCCATGTTCATGG - Intergenic
933812019 2:86038693-86038715 GCTTCATGGAAACAAGGTCAGGG - Exonic
933937347 2:87217300-87217322 GGTCCACGCATCCCAGTTCAAGG - Intergenic
936355793 2:111748502-111748524 GGTCCACGCATCCCAGTTCAAGG + Intergenic
936936701 2:117846129-117846151 CTTCCATGCTAACAAGTTCAAGG + Intergenic
943098412 2:183456947-183456969 GATCCATGCAACAAAGTTGAAGG + Intergenic
946038522 2:216764182-216764204 GCTCCAAGCCACCAGCTTCATGG - Intergenic
948601608 2:239110879-239110901 GCTCCAGGCAGACAAGTCCAGGG + Intronic
948921862 2:241069604-241069626 GCTCCACGCAGCCAGGCTCAGGG + Intronic
1170070055 20:12357217-12357239 GATCCATGCAACCCAGGCCAAGG + Intergenic
1170926153 20:20726229-20726251 GCTGAATGCACCCAAGGTCAAGG + Intergenic
1174193246 20:48754968-48754990 GCTCCATCCATCCAAGTTCTGGG + Intronic
1182202188 22:28585295-28585317 GCTGCAGGAAAACAAGTTCAGGG - Intronic
952004716 3:28830057-28830079 GATCCATGCATAGAAGTTCAAGG - Intergenic
952365524 3:32671508-32671530 GCTGCAGGAAAGCAAGTTCAGGG - Intergenic
953457874 3:43057267-43057289 ACGCCATGCAATCATGTTCATGG - Exonic
955118555 3:56031388-56031410 GCCCCATGCAACCAGGTACCAGG + Intronic
956431071 3:69186906-69186928 GATCCATACAGCCAAGTTCTGGG + Intronic
958497677 3:94865097-94865119 GATTCATGCAACCAAGACCAAGG - Intergenic
959348742 3:105233077-105233099 GCTCTATGCATTCAGGTTCATGG - Intergenic
964792085 3:160461943-160461965 GCTCCAGGCCACCAAGTTTGTGG - Intronic
975401733 4:73945809-73945831 GCTCTAGGCAGCCCAGTTCAAGG + Intergenic
975561818 4:75715665-75715687 GCTTCATGCAACAGAGTTAAAGG + Intronic
976529260 4:86132839-86132861 GCTGCAGGAAAACAAGTTCAGGG + Intronic
978558958 4:110011202-110011224 GGTCAATGCAACCAACTTCATGG + Exonic
980313921 4:131171493-131171515 GATGACTGCAACCAAGTTCAAGG + Intergenic
980428428 4:132658076-132658098 ACTGCATGCATCCAAATTCAAGG - Intergenic
983433455 4:167681143-167681165 GTTGCATGAAAACAAGTTCAGGG - Intergenic
990272592 5:54159628-54159650 GCTCCATTCAAACAATTTGATGG + Intronic
992569920 5:78044896-78044918 TCCACATTCAACCAAGTTCAAGG + Intronic
993310683 5:86328348-86328370 AATCCATTCAACCAAGTTAATGG + Intergenic
995388795 5:111616328-111616350 GATCCATGCAACCCAGACCAAGG - Intergenic
996667459 5:126076467-126076489 GCTCCATGCAACTAAGAAAAAGG - Intergenic
997226446 5:132212850-132212872 CCTCCAAGCAACCAATCTCAAGG + Intronic
999361134 5:150987720-150987742 TCTCCATGCATCCAACTTAAGGG - Intergenic
999662945 5:153884487-153884509 TCTCCCTGCAAGCAGGTTCAGGG - Intergenic
1000779077 5:165456920-165456942 GTTATATGGAACCAAGTTCAAGG - Intergenic
1001364303 5:171121720-171121742 GCTCCATGCAACTAGGTTTGTGG + Intronic
1001677747 5:173532449-173532471 GCTCCATTCACCCTATTTCAAGG - Intergenic
1002416541 5:179123760-179123782 GCTCCTGGGAACCAAGCTCATGG + Intronic
1007272893 6:40651574-40651596 GCTCACTGGCACCAAGTTCATGG + Intergenic
1012354398 6:98295539-98295561 GGTCCATGCACCAAAGTTTATGG - Intergenic
1015041399 6:128724575-128724597 TCTACTTGCAACCAAATTCAGGG + Intergenic
1019928225 7:4206954-4206976 GCGCCATGCCTCCAAGCTCATGG - Intronic
1021248584 7:18295366-18295388 GCTCCATGATACCAATTCCATGG - Intronic
1024026008 7:45410406-45410428 GCTCACTGCAGCCAAGTTCCTGG - Intergenic
1024159155 7:46656616-46656638 GCTGCATGCAGCCAACTTGATGG + Intergenic
1027185513 7:75968543-75968565 GCTCCAAGAAGCAAAGTTCACGG - Intronic
1030479274 7:110082024-110082046 GTTCCAGGAAAACAAGTTCAGGG - Intergenic
1033223510 7:139543920-139543942 GCTCCATGGCACCCAGTTCAGGG - Intronic
1035094459 7:156342246-156342268 GCTCAATACAACCAAGTTACGGG + Intergenic
1039279492 8:35968260-35968282 GATCCGTGCAACCTAGTTTAAGG + Intergenic
1041162659 8:55060956-55060978 GCTCACTGCAACCAGGTTCAAGG - Intergenic
1045953979 8:107885433-107885455 TCTCCATGCACCCATGCTCATGG + Intergenic
1048718877 8:137299542-137299564 GATCCATGCAATCCAGCTCATGG - Intergenic
1048822922 8:138396244-138396266 GCTCCATGCAGACACGGTCAAGG - Intronic
1049112570 8:140657002-140657024 CCTCCAGGCCACTAAGTTCATGG + Intergenic
1056233368 9:84569216-84569238 GCTTTAAGCCACCAAGTTCATGG + Intergenic
1056934489 9:90905490-90905512 GCTCCATGCATACATATTCAAGG + Intergenic
1057362947 9:94391804-94391826 GCTCACTGCAACCTCGTTCAAGG - Intronic
1057435364 9:95035356-95035378 GTTTGATGCAATCAAGTTCAGGG + Intronic
1057435641 9:95038040-95038062 GCTCCATGCAAGCAAGTTCTCGG + Intronic
1057660392 9:96996296-96996318 GCTCACTGCAACCTCGTTCAAGG + Intronic
1058013518 9:100004238-100004260 CCTCCATGGACCCAAGTTCTAGG - Intronic
1186478442 X:9877497-9877519 GCTCCTTGCAGGAAAGTTCAGGG + Intronic
1188167515 X:26880131-26880153 GCTCCCTGCAACCAGTTACAGGG + Intergenic
1191801956 X:65091416-65091438 GTTTCATGCCACCAAGTTTATGG + Intergenic
1197517618 X:127454866-127454888 GCTCTATGCAAGCAAATTCTTGG + Intergenic
1198786949 X:140299120-140299142 GCTTCATTAAACCAATTTCACGG - Intergenic
1200074816 X:153545738-153545760 GCTCCCTGCAAACCAGCTCAAGG - Intronic
1200272221 X:154696778-154696800 GTAGCATGCAAACAAGTTCAGGG + Intronic
1202047268 Y:20747666-20747688 GCTCCCTGCACCCTAGGTCAGGG + Intergenic