ID: 1157283988

View in Genome Browser
Species Human (GRCh38)
Location 18:46364731-46364753
Sequence GCTCACATACTGATGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157283981_1157283988 2 Left 1157283981 18:46364706-46364728 CCTGAGGCTCTCTCTGCCCATCC 0: 1
1: 0
2: 4
3: 61
4: 517
Right 1157283988 18:46364731-46364753 GCTCACATACTGATGGAGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 197
1157283980_1157283988 7 Left 1157283980 18:46364701-46364723 CCTGTCCTGAGGCTCTCTCTGCC 0: 1
1: 1
2: 4
3: 46
4: 413
Right 1157283988 18:46364731-46364753 GCTCACATACTGATGGAGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157283988 Original CRISPR GCTCACATACTGATGGAGGG TGG Intronic
903757357 1:25671947-25671969 GCTCACATGATTATGGAGGCTGG + Intronic
904289467 1:29474907-29474929 GCTCACACAATTATGGAGGTTGG + Intergenic
905017916 1:34790250-34790272 GCTCACAGTCTAATGGAGGAGGG + Intronic
905911156 1:41655747-41655769 GCTCATAAACTAGTGGAGGGAGG - Intronic
906522029 1:46473023-46473045 GCTAACATGCTGGTGGAGGTGGG + Intergenic
907913031 1:58843418-58843440 GCTCACACAATTATGGAGGCAGG - Intergenic
909891781 1:81016202-81016224 GCTCACATGTTTATGGAGGCTGG - Intergenic
910203877 1:84727758-84727780 GCTTACTTACGGATGGAGAGTGG - Intergenic
911319283 1:96393109-96393131 GGTCACATTCTGAGGGAGTGGGG - Intergenic
913071429 1:115302532-115302554 GCACACATACAGAATGAGGGTGG + Intronic
915529856 1:156497206-156497228 GGTGACTTACTCATGGAGGGAGG - Intronic
917617648 1:176762382-176762404 GTTCCCATTTTGATGGAGGGAGG + Intronic
921021470 1:211239392-211239414 GCCCACATAATTATGGAGGCTGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923436301 1:233970816-233970838 GCTCTCACACTGCTGGAGGCTGG - Intronic
1063548383 10:7004201-7004223 GCACACATACAGCTGGAGGCTGG + Intergenic
1064168963 10:13012576-13012598 GCTTATATACTGCTGGTGGGAGG + Intronic
1064468105 10:15605769-15605791 GCTCACATTCTGGTGGACTGTGG - Exonic
1065244645 10:23744757-23744779 GCTCACATGATTATGGAGGCTGG + Intronic
1066061011 10:31723599-31723621 CCTCACATTCTCATGCAGGGCGG + Intergenic
1068390983 10:56396486-56396508 GATCACATAATTATGGAGGCTGG + Intergenic
1069224330 10:65923039-65923061 CCCCACATATTGAGGGAGGGAGG - Intronic
1071285803 10:84143741-84143763 CCTCAAATATTGTTGGAGGGAGG + Intronic
1072076918 10:91985593-91985615 TCTCACATACTGATGGTCAGAGG - Intronic
1074794658 10:116930386-116930408 GCTTACTTGATGATGGAGGGTGG - Intronic
1075231419 10:120682442-120682464 GCTCACATTCGAATGGAGGAAGG + Intergenic
1076637174 10:131889713-131889735 GCTCACATACGCATGGAGGTGGG + Intergenic
1078532152 11:12145031-12145053 GCCCACATCCTGATGAAGGAAGG + Intronic
1080771258 11:35344200-35344222 GCTTACATACTGAAAGAGGGAGG + Intronic
1081178819 11:39962399-39962421 TCTAACACAGTGATGGAGGGAGG - Intergenic
1082951006 11:58815964-58815986 CCTCACATAGTCATGGGGGGCGG + Intergenic
1084779116 11:71397133-71397155 GCTCACACAGTGACGGAGGCCGG - Intergenic
1088501590 11:110488791-110488813 ACTCACACAATTATGGAGGGTGG - Intergenic
1090528950 11:127569153-127569175 GCTCACATGATTATGGAGGCTGG - Intergenic
1091064022 11:132491761-132491783 GCTTACATCCTGGTGGAGGAGGG + Intronic
1092483295 12:8879982-8880004 GCTCACAGACTAGTGGAGGGAGG + Intronic
1092655809 12:10684471-10684493 GCTCACATGATTATGGAGGCTGG + Intergenic
1093757237 12:22866422-22866444 GCTGACATAATCATGGAGAGAGG - Intergenic
1095126917 12:38490335-38490357 CCTCAGATACTGATGGGGAGGGG + Intergenic
1096660876 12:53123282-53123304 GATCCCAGACTGATGGTGGGAGG + Intronic
1100150448 12:91730296-91730318 GCTCACATAATTATGGAGGTGGG - Intergenic
1102414396 12:112748003-112748025 ACTCACATTCTGATGGAGACAGG + Intronic
1102774926 12:115510244-115510266 GCTCACATAATCATGGGGGCTGG - Intergenic
1102817368 12:115878130-115878152 GCTCACATTCTATTGGAGGAGGG + Intergenic
1102866312 12:116377689-116377711 GCTCAGATATAGATGGAGGAGGG - Intergenic
1107173407 13:37370843-37370865 GCTCACATGATGATGGGGGCTGG - Intergenic
1108423666 13:50276459-50276481 GCCCACATACAGAGAGAGGGTGG - Intronic
1108505302 13:51107551-51107573 GCTTGCATCCGGATGGAGGGAGG + Intergenic
1110589233 13:77235693-77235715 GCTCACATTCTAATGAGGGGAGG + Intronic
1113868401 13:113543498-113543520 GGTCACACACAGATGGAGGGCGG - Intronic
1116818878 14:49608817-49608839 GTTCGCATAGTGATGAAGGGTGG + Intronic
1117278349 14:54212592-54212614 GCTCACACAGTTATGGAGGCTGG + Intergenic
1118316192 14:64727645-64727667 GCTGCCATCCTGGTGGAGGGAGG - Exonic
1120385035 14:83834123-83834145 GCTCACATTATTATGGAGGTTGG + Intergenic
1120955257 14:90076517-90076539 GCTCACGTACAGATGGGGGTTGG - Intronic
1121285078 14:92728969-92728991 GCTGACATACTGGTGGAAGAAGG - Intronic
1126565118 15:50088682-50088704 GCTCACATTCTGGTCGGGGGCGG - Intronic
1126782673 15:52151657-52151679 ACTCACATACTGCTGTTGGGAGG - Intronic
1127702038 15:61510765-61510787 TCTGACACACAGATGGAGGGAGG - Intergenic
1128963803 15:72037169-72037191 GCACACATAGTGATGGTGGGTGG - Intronic
1132180068 15:99745552-99745574 GCCCATATACTGTCGGAGGGAGG + Intergenic
1133738621 16:8634430-8634452 GATCAAATTCTGGTGGAGGGGGG - Intronic
1135067410 16:19322164-19322186 GCTCACATGATTATGGAGGTTGG - Intergenic
1135289777 16:21225318-21225340 TCTCACGTGCTGAGGGAGGGAGG + Intergenic
1135326787 16:21531138-21531160 GCTCACGTTCTGATGGAAGGAGG - Intergenic
1136337042 16:29616552-29616574 GCTCACGTTCTGACGGAAGGAGG - Intergenic
1137744573 16:50811221-50811243 GTTCTCATACTGATGGAAAGGGG + Intergenic
1137746735 16:50826890-50826912 GCTCACATGATTATGGAGGCTGG + Intergenic
1137905794 16:52320654-52320676 GCTTACATTCTAATGGAGGGGGG - Intergenic
1138407698 16:56811217-56811239 TCTCACATACTGCTGGTGGGAGG - Intronic
1141802451 16:86320041-86320063 GCTCACATGCCGAAGGTGGGAGG - Intergenic
1142039836 16:87885888-87885910 GCTCACATTCTGATGGAAGGAGG - Exonic
1144379926 17:14684700-14684722 ACTTACATACTGTTGGTGGGAGG - Intergenic
1145007983 17:19348241-19348263 GCTCCCTTCCTGATGGAGGCGGG + Intronic
1147207968 17:38852443-38852465 GCTCATATTGTGTTGGAGGGGGG - Intronic
1149186500 17:54004276-54004298 GCTCACACAATTATGGAGGCTGG + Intergenic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1151049111 17:70956648-70956670 GCTCACATGATGGTGGAGGCTGG + Intergenic
1157283988 18:46364731-46364753 GCTCACATACTGATGGAGGGTGG + Intronic
1157465236 18:47938394-47938416 GACCACATACTGAGGGAGGAAGG + Intergenic
1157669644 18:49517526-49517548 GCTCACGTGATGATGGAGGCTGG + Intergenic
1158372218 18:56821143-56821165 GCTTACATTTTCATGGAGGGAGG + Intronic
1158393215 18:57060304-57060326 ACACACAGACTGATGGAGGTAGG + Intergenic
1158467774 18:57706685-57706707 GGTCACATTCTGAGGGATGGAGG - Intronic
1159450705 18:68598518-68598540 GCTCACATGATTATGGAGGCTGG - Intergenic
1159709448 18:71737239-71737261 GCTCACATGATTATGGAGGTTGG - Intronic
1161116824 19:2501870-2501892 GAGCGCAGACTGATGGAGGGAGG - Intergenic
1161435383 19:4259751-4259773 GCTCAGATTCTAAAGGAGGGAGG - Intronic
1163243535 19:16078128-16078150 GCTGACTCACTGATGGAGCGAGG + Intronic
925771752 2:7289031-7289053 GGTCACATCCTGATGGCGGGGGG + Intergenic
925817805 2:7770166-7770188 CCCCACATATTGAGGGAGGGAGG - Intergenic
926649499 2:15326855-15326877 ACTCACATGCTGCTGGAGAGAGG - Intronic
928179349 2:29057014-29057036 GCTCTCCTTGTGATGGAGGGAGG + Exonic
928213264 2:29339685-29339707 GGTGACATAGAGATGGAGGGAGG + Intronic
929043549 2:37769796-37769818 GCTCACACAATTATGGAGGCTGG + Intergenic
930283577 2:49400682-49400704 CCTCACATACAGATGGAGATAGG + Intergenic
938137971 2:128774828-128774850 GCTCACTTTGGGATGGAGGGAGG + Intergenic
938161105 2:128985252-128985274 GCTGACAGACTCATGGAGTGTGG + Intergenic
939440503 2:142243505-142243527 TCTCACATATTGATGATGGGAGG + Intergenic
939483996 2:142786064-142786086 GCTCACATAATTATGGAGGCTGG - Intergenic
946197006 2:218039505-218039527 GCTCACAGGCTGGGGGAGGGTGG + Intronic
946297814 2:218799636-218799658 GCTCACATGATTATGGAGGTTGG - Intronic
946643049 2:221804770-221804792 GCTCACACAATTATGGAGGCTGG - Intergenic
947202060 2:227622631-227622653 GCTCCCATGGTGATGGAGGCTGG + Intronic
947478580 2:230475145-230475167 GCTCATACACTGTTGGTGGGAGG - Intronic
947565327 2:231189776-231189798 GCTCACAGAGGGAGGGAGGGAGG + Intergenic
1169172992 20:3480594-3480616 CCTAACATACAGAGGGAGGGAGG + Intronic
1169334861 20:4747812-4747834 GCTCAAATACTGGTAGAGGATGG + Intergenic
1169626300 20:7573655-7573677 GCTCACATGATTATGGAGGCTGG + Intergenic
1169646684 20:7818883-7818905 GCTCACATAGTCATAGAGGTTGG + Intergenic
1169799092 20:9496830-9496852 GCTCACACAGTTATGGAGGCTGG + Intergenic
1169800998 20:9511572-9511594 GTTGACAAACTGATGTAGGGTGG - Intergenic
1171990738 20:31694361-31694383 GCTCAGATACCAAGGGAGGGTGG + Intronic
1173337440 20:42124294-42124316 GCTCACAGACAGATGGAGGCAGG - Intronic
1176093204 20:63328098-63328120 GCTCACAAGCTGGTAGAGGGTGG - Exonic
1181016059 22:20069611-20069633 GCTCCCATTCTGATGGAGACAGG - Intergenic
1184898721 22:47430214-47430236 GCTTAAATTCTTATGGAGGGAGG - Intergenic
1185349230 22:50326023-50326045 GCCCACCTGCAGATGGAGGGAGG - Intronic
949949280 3:9215944-9215966 GCTCACATCATAATGGAGGTTGG - Intronic
950637253 3:14323817-14323839 ACTCACAGACTGATGGAGGATGG + Intergenic
951745170 3:25970441-25970463 GCTCACATGACTATGGAGGGTGG - Intergenic
952528659 3:34240825-34240847 GCACACATACACATGCAGGGAGG + Intergenic
952549256 3:34457241-34457263 GCTCAGATACTGATCATGGGGGG + Intergenic
953060793 3:39427365-39427387 GCTCACTTTCTGTAGGAGGGAGG + Intergenic
953337121 3:42102882-42102904 GCACACGTACTGATAGAGGCAGG - Intronic
954164606 3:48746184-48746206 GCTCACACAGTTATGGAGGTGGG - Intronic
955663589 3:61327233-61327255 CCTCAGAACCTGATGGAGGGTGG + Intergenic
957334567 3:78810435-78810457 TCTTAGAAACTGATGGAGGGTGG + Intronic
959860348 3:111208666-111208688 GCTCACATCCAGACTGAGGGAGG - Intronic
962346966 3:134625555-134625577 GCTCACAAGCTCAAGGAGGGAGG + Intronic
963052422 3:141153364-141153386 GGACACACACTGATGAAGGGTGG + Intergenic
963797616 3:149646855-149646877 GCTCAAACACTGTTGGAGGGAGG - Intronic
964679280 3:159319234-159319256 GCTCACATTCAGATGGTGAGTGG - Intronic
966489684 3:180514331-180514353 GCTCACATAATTATGGGGGATGG + Intergenic
966860371 3:184228386-184228408 GCTCAGATACTCAAGGAGGCAGG + Intronic
968785774 4:2621341-2621363 GATCACCTACTGAGGGAGGCTGG - Intronic
969185481 4:5471228-5471250 GGTCACATTCTGAAGTAGGGGGG - Intronic
969443430 4:7231103-7231125 GCTCACATAAAGATGGAGGCTGG + Intronic
970124528 4:12793900-12793922 TCACACAATCTGATGGAGGGTGG - Intergenic
971735914 4:30451964-30451986 GCTCACACAATTATGGAGGCTGG - Intergenic
972602094 4:40581871-40581893 GCTCACAGAGTGGAGGAGGGAGG - Intronic
972627190 4:40811299-40811321 GCTCACATACTTTGGGAGGTTGG + Intronic
972963287 4:44479827-44479849 TCACACATTCTGTTGGAGGGAGG - Intergenic
977586588 4:98781269-98781291 GCTCACATGATAATGGAGGCTGG - Intergenic
978237235 4:106473918-106473940 GCCTACATTCTGGTGGAGGGAGG + Intergenic
980006125 4:127544391-127544413 GCTCATATACTTATGGAGCCTGG - Intergenic
981073344 4:140568159-140568181 GCTCACGCGCAGATGGAGGGAGG + Intronic
981847925 4:149191085-149191107 GCTCACAGACGGATGGTGGGGGG + Intergenic
982952452 4:161716726-161716748 TCTCACATTCTACTGGAGGGTGG - Intronic
983654568 4:170069756-170069778 GCTGGCATGCTGATGGTGGGAGG + Intronic
983861538 4:172713304-172713326 GCTCACATGATCATGGAGGCTGG + Intronic
983936563 4:173506845-173506867 GCTCCCAGACCGATGGAGGTCGG - Intergenic
984344425 4:178504422-178504444 GCTCACACAGTTATGGAGGTTGG + Intergenic
987951643 5:24684214-24684236 GCTCACATGATTATGGAGGCTGG - Intergenic
988274279 5:29060292-29060314 GCTCACTTAATTATGGATGGAGG + Intergenic
990166789 5:53003465-53003487 TCTCACATACTGTTAGAGGGAGG + Intronic
991949430 5:71933289-71933311 GCTGACAGGCTGGTGGAGGGAGG - Intergenic
992877198 5:81068712-81068734 GTTCACACTCTGAGGGAGGGAGG - Intronic
994373735 5:98995033-98995055 GCTCACATAATTGTGGAGGGTGG - Intergenic
994522859 5:100863300-100863322 GCACACACACTAAAGGAGGGAGG + Intronic
994813312 5:104550768-104550790 GCTTACATACTGATGTACTGAGG + Intergenic
995405408 5:111789060-111789082 GCTCACACAGTTATGGAGGTGGG - Intronic
995536015 5:113137297-113137319 ACCCACATATTGAGGGAGGGAGG - Intronic
996508587 5:124294217-124294239 CCTCACATGTTGAGGGAGGGAGG + Intergenic
1001516710 5:172360454-172360476 CCTCACACACTGCTGGAGGGAGG + Intronic
1002147460 5:177196150-177196172 GCTCACAGAGTAAGGGAGGGTGG + Intronic
1002417644 5:179129147-179129169 GCTCACACACTGATGCAGGCAGG + Intronic
1003268365 6:4586482-4586504 GCTCACACAATTATGGAGGCTGG + Intergenic
1004070790 6:12295639-12295661 GGTCACATAGTGATGAAGGTTGG + Intronic
1004904686 6:20226293-20226315 GCTCACATGTTTATGGAGGCTGG - Intergenic
1007421329 6:41721567-41721589 GCACAGATACTTTTGGAGGGAGG - Intronic
1007569284 6:42877820-42877842 GGTCACACACTGAAAGAGGGAGG - Intergenic
1013279967 6:108626974-108626996 GCTGACATACTGATTGATGGTGG + Intronic
1013400807 6:109794534-109794556 CCACAGATACTGATGGAGGGAGG - Intronic
1014218749 6:118779042-118779064 GGGCACATCCTGATGGAGGTAGG + Intergenic
1015470752 6:133603462-133603484 GCTCACATGATTATGGAGGCAGG + Intergenic
1017618045 6:156265879-156265901 GTTAACATGCAGATGGAGGGAGG + Intergenic
1018165170 6:161087178-161087200 GCTCCCATACTGAGAGTGGGAGG + Intronic
1020344317 7:7146738-7146760 GCTCTCTTACTGATGCAGGTAGG + Intergenic
1020914450 7:14174901-14174923 GTACACATACTGGTGAAGGGAGG + Intronic
1022186774 7:27976944-27976966 GCTCACATTCTGGTAGAAGGAGG + Intronic
1023565831 7:41522859-41522881 GCCTACAGAGTGATGGAGGGTGG + Intergenic
1024252827 7:47519458-47519480 GCTCACACACTGAGTGAGGTGGG - Intronic
1024332489 7:48170064-48170086 GCTCACACAGTCATGGAGGTGGG - Intergenic
1024385079 7:48741800-48741822 ACTCACACAGTGATGGAGTGGGG - Intergenic
1027567054 7:79808207-79808229 GCTTAAATTCTAATGGAGGGAGG - Intergenic
1027622915 7:80514174-80514196 GCTGACAAACTGATAGAGGCTGG + Intronic
1030474924 7:110019407-110019429 GCTGAGATACTGATGGAAGCTGG + Intergenic
1030789385 7:113705248-113705270 GCTCACATGATTATGGAGGCTGG - Intergenic
1031579862 7:123459589-123459611 GCTCACATAATTGTGGAGGCTGG - Intronic
1034491251 7:151394269-151394291 GCTCACATTCGCGTGGAGGGAGG - Intronic
1036151686 8:6305001-6305023 GATCAGATACTGATGGTGGCAGG + Intergenic
1037492883 8:19412403-19412425 GCTCACATGCAGCTGCAGGGCGG - Intronic
1039387347 8:37147804-37147826 GCTCACCGAGTGATGGACGGTGG - Intergenic
1039835443 8:41252790-41252812 GCTGAAATACTGGTGGATGGGGG - Intergenic
1040681052 8:49809746-49809768 CCTCACATGTTGAGGGAGGGAGG + Intergenic
1040721334 8:50328645-50328667 CCCCACATGCTGAGGGAGGGAGG - Intronic
1040947912 8:52903686-52903708 GCTTACATACTAGTGGAGAGAGG - Intergenic
1040995225 8:53394265-53394287 GCTCTCATACTGAGGAAAGGAGG + Intergenic
1043517185 8:81005696-81005718 GCTCTGATACAGATGGAGGCTGG - Intronic
1043610585 8:82057788-82057810 GCTCAGATATTGAGGGTGGGAGG - Intergenic
1043909575 8:85845999-85846021 GCTCACATGATTATGGAGGGGGG + Intergenic
1044804355 8:95989697-95989719 GCTCACACAATCATGGAGGCTGG - Intergenic
1045397527 8:101775678-101775700 GCTCAGATCCAGATGGAGGTTGG + Intronic
1046239355 8:111470882-111470904 GATGACATATTGATGGAGGCAGG + Intergenic
1047284082 8:123471464-123471486 GCTCACATGATTATGGAGGCTGG + Intergenic
1054788727 9:69235082-69235104 GCTCACATAATTATGGAGACTGG + Intronic
1056197781 9:84245354-84245376 GCTCACGTGATGATGGAGGCTGG + Intergenic
1056678000 9:88692793-88692815 GCTCACATACCCAGGAAGGGTGG + Intergenic
1057062416 9:92017415-92017437 GGTCATATACTGATGTTGGGGGG + Intergenic
1058071897 9:100609899-100609921 GCTCACATGATTATGGAGGCTGG + Intergenic
1058155824 9:101513730-101513752 GCTCACATAATTATGGAGACAGG + Intronic
1059551005 9:115228801-115228823 GCTCACAAAGTGATGAAGGCTGG - Intronic
1059862690 9:118482564-118482586 TGTCACATACTGCTGGAGGGAGG + Intergenic
1185716363 X:2345886-2345908 GCTCATATGGTGATGGAGGCTGG - Intronic
1186549546 X:10488410-10488432 TCTCACAAACTGCTGGAGGTGGG - Intronic
1186998263 X:15147589-15147611 GCTCAGAGAGTGATGGAGGTTGG + Intergenic
1188096646 X:26031759-26031781 GCCTACTTACTGGTGGAGGGTGG + Intergenic
1193325055 X:80170666-80170688 GCTCACATAATTATGCAGAGTGG + Intergenic
1194335234 X:92638922-92638944 GCTCACACACTGTTGATGGGAGG + Intergenic
1194893929 X:99415698-99415720 GCCAACATACTGGTGGAGTGAGG + Intergenic
1197891890 X:131277126-131277148 GCTCATATGCTGGTGGGGGGTGG + Exonic
1200643703 Y:5755956-5755978 GCTCACACACTGTTGATGGGAGG + Intergenic