ID: 1157287845

View in Genome Browser
Species Human (GRCh38)
Location 18:46389537-46389559
Sequence GTCTAGAGTTTGCTGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157287838_1157287845 14 Left 1157287838 18:46389500-46389522 CCACAGCTGATGAGAGCAGAGAC 0: 1
1: 0
2: 1
3: 40
4: 238
Right 1157287845 18:46389537-46389559 GTCTAGAGTTTGCTGTTGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 131
1157287835_1157287845 28 Left 1157287835 18:46389486-46389508 CCCTGGCTCAAGGCCCACAGCTG 0: 1
1: 0
2: 7
3: 36
4: 296
Right 1157287845 18:46389537-46389559 GTCTAGAGTTTGCTGTTGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 131
1157287837_1157287845 15 Left 1157287837 18:46389499-46389521 CCCACAGCTGATGAGAGCAGAGA 0: 1
1: 0
2: 1
3: 25
4: 263
Right 1157287845 18:46389537-46389559 GTCTAGAGTTTGCTGTTGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 131
1157287836_1157287845 27 Left 1157287836 18:46389487-46389509 CCTGGCTCAAGGCCCACAGCTGA 0: 1
1: 0
2: 4
3: 32
4: 279
Right 1157287845 18:46389537-46389559 GTCTAGAGTTTGCTGTTGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 131
1157287834_1157287845 29 Left 1157287834 18:46389485-46389507 CCCCTGGCTCAAGGCCCACAGCT 0: 1
1: 0
2: 4
3: 29
4: 334
Right 1157287845 18:46389537-46389559 GTCTAGAGTTTGCTGTTGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157287845 Original CRISPR GTCTAGAGTTTGCTGTTGTC AGG Intronic
901870190 1:12134283-12134305 ATCTGGAATATGCTGTTGTCAGG - Intronic
904839070 1:33359406-33359428 GACTAGAGTTTGATGTTACCTGG + Intronic
906101371 1:43265745-43265767 ATCTGGAGTTTGCTGTTGAATGG - Intronic
906736970 1:48138723-48138745 ATCTGGAGTTTGCTGTTGAATGG + Intergenic
910056901 1:83044365-83044387 GTCTACATTTTGCTATTGCCAGG + Intergenic
910543157 1:88384031-88384053 GGCTATAGTTTTCTGGTGTCTGG + Intergenic
916625879 1:166554090-166554112 ATCTAGAGTTTGCTGTTAAATGG + Intergenic
916872436 1:168930866-168930888 TTTTTGAGTTTGCTTTTGTCAGG - Intergenic
917011236 1:170474250-170474272 GTCTAGAGTTGCCTGTCTTCTGG - Intergenic
917348123 1:174049915-174049937 GTCTAGTGGATGCTGTGGTCTGG - Intergenic
921946352 1:220888428-220888450 ATCTGGAGTTTGATGTTGGCAGG + Intergenic
922076764 1:222253010-222253032 GCCTAGAGCATGGTGTTGTCAGG - Intergenic
922667484 1:227484901-227484923 ATCTAGCATTTGCTGTTCTCTGG - Intergenic
1065162514 10:22937715-22937737 GTGTACTGTTTGCTGATGTCAGG - Intronic
1072269617 10:93763370-93763392 CTCTAGACTTTACTGATGTCTGG + Intronic
1072341029 10:94450006-94450028 GCCTAGAGTTTGCTAATATCAGG - Intronic
1074393876 10:113080817-113080839 CTCTGGAGTTTGATGTTGTCAGG + Intronic
1079068470 11:17320367-17320389 GTTTAGATTTTGTTGTTGTTGGG + Intronic
1081004726 11:37721336-37721358 GTTGAGAGTGTGCTGTTCTCTGG - Intergenic
1082778190 11:57263963-57263985 ATCTGGAGTTTGCTGTTGAATGG + Intergenic
1082955892 11:58869280-58869302 ATCTGGAGTTTGCTGTTGAGTGG + Intronic
1082972508 11:59038281-59038303 ATCTGGAGTTTGCTGTTGAATGG + Intronic
1082976977 11:59082183-59082205 ATCTGGAGTTTGCTGTTGAATGG + Intergenic
1084442748 11:69184551-69184573 GTCTTGTGTTTTCTGTTGTCTGG - Intergenic
1084988949 11:72904852-72904874 CTGTAGAGTTTCCTGTAGTCTGG + Intronic
1094590549 12:31815527-31815549 GGCTGGAGTTTGCTGATCTCTGG - Intergenic
1096578399 12:52569222-52569244 GTTTAAAATTTGCTGCTGTCAGG + Intronic
1098934049 12:76456657-76456679 GCCTACTGTTTGCTGTTGACTGG + Intronic
1099349495 12:81547067-81547089 GCCTAGATTTTGGTGTTGGCAGG + Intronic
1107030778 13:35851450-35851472 GTCTAGAGTTGGCTTTTCTCCGG + Intronic
1108383362 13:49875395-49875417 ATCTGGAGTTTGCTGTTGAATGG + Intergenic
1108718306 13:53104325-53104347 TTCTGGAGGTTGCTGTTGGCTGG + Intergenic
1110763147 13:79252623-79252645 GTTTTGAGTCTGCTGTTGTTTGG - Intergenic
1112338154 13:98531542-98531564 GTCTAGGGTTGGCTGGTGTGTGG - Intronic
1117499232 14:56335771-56335793 TTCTAGAGTTTGGTGCTTTCAGG - Intergenic
1122812230 14:104294780-104294802 GTGTCGAGTCTGCTGGTGTCCGG + Intergenic
1124062678 15:26308466-26308488 ATCTGGAGTTTGCTGTTGAATGG + Intergenic
1124071774 15:26401693-26401715 GTTTGGAGTTTGTTGTTGCCGGG + Intergenic
1124349973 15:28948096-28948118 GTATAGAGTCTACTGTTTTCAGG + Intronic
1132277913 15:100585358-100585380 ATCTGGAGTTTGCTGTTGAATGG + Intronic
1146443686 17:32918574-32918596 ATCTGGAGTTTGCTGTTGAATGG + Intergenic
1146755824 17:35431413-35431435 ATCTGGAGTTTGCTGTTGAATGG - Intronic
1149196787 17:54131331-54131353 GTCTTGGGTTTGCTCTTCTCGGG + Intergenic
1156435635 18:37125450-37125472 GTGTATAATTTGCTGTTTTCTGG - Intronic
1157287845 18:46389537-46389559 GTCTAGAGTTTGCTGTTGTCAGG + Intronic
1158296220 18:55999668-55999690 GCCTGGAGTTTTCTATTGTCAGG - Intergenic
1159640843 18:70860986-70861008 GTATAGAATTTGCAGTTGACAGG + Intergenic
1164486347 19:28658761-28658783 TTCTTGAGTTTGCTTTTGTTTGG - Intergenic
1168672809 19:58254283-58254305 ATCTGGAGTTTGCTGTTGAATGG - Intronic
926633267 2:15156728-15156750 GTTTAGCTTTTGCTGTGGTCTGG - Intergenic
928057370 2:28071347-28071369 GTCTAGATTTTGCTGATTGCAGG + Intronic
929980847 2:46678769-46678791 GCCTAGAGTTTCCTGCAGTCTGG - Intergenic
933577060 2:84081173-84081195 GTCCAGAGATAGTTGTTGTCAGG - Intergenic
935428824 2:102950812-102950834 TTCTAGAGGTTGTTTTTGTCAGG + Intergenic
937624292 2:124025678-124025700 GTTTTGACTTTGCTGTTCTCTGG + Exonic
938138719 2:128779806-128779828 GCTGAGAGTTTGCTGTGGTCAGG + Intergenic
938175989 2:129129260-129129282 ATCTGGAGTTTGCTGTTGAATGG + Intergenic
940308218 2:152248925-152248947 GACTAGAGTTTCCTTTAGTCTGG + Intergenic
940859186 2:158754607-158754629 GTCTAGGGTTTGTTTTTGTTTGG + Intergenic
944102789 2:196046574-196046596 GTTTCGAGTTTGCTTTTGCCAGG - Intronic
1169692246 20:8344777-8344799 CTCTAGGTTTTGCTTTTGTCTGG + Intronic
1170979907 20:21202324-21202346 GGCTAGAATTTGCTGATGACTGG + Intronic
1171285614 20:23935990-23936012 ATCTGGAGTTTGCTGTTGAATGG - Intergenic
1175471259 20:59230630-59230652 GGCTATAGTTTGCTGATGCCTGG + Intronic
1175856688 20:62124395-62124417 ATCTAGAGCTGTCTGTTGTCTGG + Intronic
949387949 3:3525707-3525729 GTTTAGAGGTTGCCGTTTTCTGG - Intergenic
949621713 3:5820315-5820337 GTCTAGAGTTTCCTGTTACACGG - Intergenic
951377219 3:21933772-21933794 GTTTAGATTTTGTTGTTTTCAGG - Intronic
951734097 3:25844445-25844467 TTCCAGATTTTGCTGTTTTCTGG - Intergenic
957718965 3:83969669-83969691 ATCTGGAGTTTGCTGTTGAATGG + Intergenic
959852595 3:111107469-111107491 GTCTAGAGTGTGCAGTAGCCAGG + Intronic
960940727 3:122931897-122931919 GTCGAGGGGTTGCTGTTGTCTGG + Intronic
962049413 3:131797005-131797027 GTCTAGAGGTTGCAGGTGACTGG - Intronic
962121377 3:132564228-132564250 GTCTATGGTTTGTTCTTGTCTGG + Intronic
962426739 3:135276014-135276036 GTTTATATTTTGCTGTAGTCAGG + Intergenic
963744639 3:149114095-149114117 ATCTGGAGTTTGCTGTTGAATGG - Intergenic
964431394 3:156610332-156610354 GTCTGGAGGTTGATGATGTCGGG + Intergenic
965206397 3:165722877-165722899 GTATAGAGTTTTCTATTTTCTGG + Intergenic
966046395 3:175556024-175556046 CTCTGGAGTCTGCTGTTCTCTGG - Intronic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
969388477 4:6872902-6872924 GTGGAGCGTTTGCTGTTCTCTGG + Intronic
970140630 4:12978311-12978333 GTATTGAGTTTGCAGTTGTAAGG - Intergenic
971447817 4:26770642-26770664 ATGTATAGTTTGCTGTTGTTGGG - Intergenic
984282559 4:177689511-177689533 CTCTAAAGTATGCTGTTGTTTGG + Intergenic
984399748 4:179246848-179246870 GTCTAAAATTTGATGTTCTCTGG + Intergenic
985821441 5:2163475-2163497 ATCTAGTGTTTGCTGCTTTCTGG + Intergenic
987163329 5:15168162-15168184 GATTCGAGTTTGCTGTTGCCAGG + Intergenic
988979524 5:36552731-36552753 GTCTAGAGTTTCCTATGTTCTGG - Intergenic
989011559 5:36877303-36877325 GTCTAGAGTTCGCTCCTCTCTGG + Intronic
991087655 5:62662934-62662956 GTCTAGATTTTGCTGGTGAGTGG - Intergenic
992033842 5:72751730-72751752 GTCTGTAGTTTTCTGTTTTCTGG - Intergenic
992241875 5:74779849-74779871 GTCTATAGTAAGCTGATGTCAGG - Exonic
996531507 5:124532395-124532417 GTCCAGAGCGTGCTGATGTCCGG + Intergenic
997577010 5:134986757-134986779 GTTAAGAGTATGCTGTTGGCTGG - Intronic
999657418 5:153824470-153824492 TTCTAGAGTTTTTTGTTTTCTGG - Intergenic
1000079019 5:157826930-157826952 ATGTACAGTTTGCAGTTGTCAGG - Intronic
1000568311 5:162880042-162880064 ATCTGGAGTTTGCTGTTGCATGG - Intergenic
1003133777 6:3417410-3417432 GCTTGGAATTTGCTGTTGTCAGG + Intronic
1003314910 6:5003628-5003650 GTCTGGAGGGAGCTGTTGTCAGG - Intronic
1004586415 6:17005907-17005929 TTCTAGTGTTTGCTGTTATTAGG + Intergenic
1008856717 6:56097084-56097106 GTCTCAAATTTGCTGATGTCTGG - Intronic
1009637772 6:66287452-66287474 ATGTAAATTTTGCTGTTGTCGGG + Intergenic
1009906286 6:69873363-69873385 GTCAAGAGTTAGCTGTTTGCAGG + Intronic
1010795441 6:80112473-80112495 TTCTGGAGTTTGCTGTTGAATGG - Intronic
1014908940 6:127065650-127065672 CTATAGAGTTTGCTCTTGGCTGG + Intergenic
1015123550 6:129727404-129727426 TTCTTGATTTTGCTGTTCTCAGG - Intergenic
1015650885 6:135457847-135457869 CACTATGGTTTGCTGTTGTCTGG - Intronic
1015892471 6:137982584-137982606 GTCTAGAATTTCCTGAAGTCTGG - Intergenic
1016191841 6:141277911-141277933 GTATAGAATTTGATATTGTCAGG + Intergenic
1018187858 6:161283200-161283222 TTCTAAAGTTTGCTGGTGGCTGG - Intergenic
1018653938 6:166014265-166014287 GACTAAAGGATGCTGTTGTCAGG + Intergenic
1019929953 7:4216746-4216768 GCCAAGAGTTTGCAGATGTCAGG - Intronic
1022458154 7:30577923-30577945 ATCTGGAGTTTGCTGTTGAATGG - Intergenic
1022953719 7:35362745-35362767 GTGTGGAGTTTGCTGTTCTTGGG + Intergenic
1023885576 7:44351969-44351991 ATATGGAGTTTGCTGTTGACAGG - Intergenic
1023951231 7:44847862-44847884 GTCGGGAGTTTGCGGGTGTCTGG - Intronic
1027517035 7:79155391-79155413 GCCTAGAGTTTGCTCTAGTGGGG + Intronic
1027823759 7:83084102-83084124 GTCTAGAATTGCGTGTTGTCAGG - Intronic
1028600889 7:92599195-92599217 TTCTAGGGTTTGCTGGTGCCTGG + Intergenic
1028678956 7:93503223-93503245 GTCTGGAATATGCTGTTCTCAGG + Intronic
1050163464 9:2741318-2741340 GGCTAGAGTTTGGAGTTGACAGG + Intronic
1050994361 9:12194990-12195012 GTTTAAAGATTGCTGTTGGCAGG - Intergenic
1052488122 9:29128478-29128500 ATCTGGAGTTTGCTGTTGAATGG + Intergenic
1055474097 9:76644198-76644220 GACTGGGGTTGGCTGTTGTCAGG + Intronic
1060212107 9:121716874-121716896 GTGTCCACTTTGCTGTTGTCAGG + Intronic
1061414185 9:130437356-130437378 GACCAGAGTTTGCTGATCTCTGG + Intergenic
1062302621 9:135883698-135883720 GTCAAGAGTTTGATGCTGCCTGG - Intronic
1203451882 Un_GL000219v1:124801-124823 GTCTAGAATTTGTTATTTTCAGG + Intergenic
1186820425 X:13282500-13282522 TTCTTGATTTAGCTGTTGTCTGG - Intergenic
1187739636 X:22341570-22341592 GTCATGAGTTTTTTGTTGTCTGG + Intergenic
1188908118 X:35812607-35812629 GTGTAAATTTTGCTGTTGGCTGG - Intergenic
1190828624 X:54041448-54041470 TTCTAGAATTTTCAGTTGTCTGG - Intronic
1191191492 X:57673400-57673422 ATCTGGAGTTTGCTGTTGAATGG - Intergenic
1192936247 X:75861686-75861708 GTCTTGTGTTTGCTCTTCTCTGG + Intergenic
1195112607 X:101662689-101662711 TTCTTTGGTTTGCTGTTGTCAGG + Intergenic
1198294643 X:135273817-135273839 ATCTGGAGTTTGCTGTTGAATGG + Intronic