ID: 1157288450

View in Genome Browser
Species Human (GRCh38)
Location 18:46393331-46393353
Sequence GGTGTGGGGTGCATCTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157288445_1157288450 -3 Left 1157288445 18:46393311-46393333 CCGGTGGAGAGCAGTCTCGAGGT 0: 1
1: 0
2: 1
3: 15
4: 192
Right 1157288450 18:46393331-46393353 GGTGTGGGGTGCATCTGGCCAGG 0: 1
1: 0
2: 2
3: 20
4: 240
1157288441_1157288450 15 Left 1157288441 18:46393293-46393315 CCCAGCTCTTGTTCTGGGCCGGT 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1157288450 18:46393331-46393353 GGTGTGGGGTGCATCTGGCCAGG 0: 1
1: 0
2: 2
3: 20
4: 240
1157288442_1157288450 14 Left 1157288442 18:46393294-46393316 CCAGCTCTTGTTCTGGGCCGGTG 0: 1
1: 0
2: 1
3: 7
4: 96
Right 1157288450 18:46393331-46393353 GGTGTGGGGTGCATCTGGCCAGG 0: 1
1: 0
2: 2
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157288450 Original CRISPR GGTGTGGGGTGCATCTGGCC AGG Intronic
900154665 1:1199141-1199163 GGTGGGGGCTGCCCCTGGCCTGG - Intergenic
900438543 1:2642474-2642496 GCTGTGGGCTGCTGCTGGCCAGG + Intronic
900472932 1:2863486-2863508 GATTTGGGGTGAATGTGGCCTGG - Intergenic
900740582 1:4328534-4328556 TGTGTGGAGGGCACCTGGCCTGG + Intergenic
901490991 1:9596102-9596124 GGTGTGGGGTCCATGAGCCCCGG - Intronic
902137634 1:14324029-14324051 GCTGTGGGCTGCATTTGGCAAGG - Intergenic
902478372 1:16699673-16699695 GGTCTGGGTCACATCTGGCCGGG + Intergenic
903063823 1:20687412-20687434 TGCCTGGGGTGCATCTGTCCTGG + Exonic
903674759 1:25056629-25056651 TGTGGGGGGTGCAGGTGGCCAGG + Intergenic
903777226 1:25800573-25800595 GGTGGGGGGTGCCTGGGGCCGGG + Intronic
904566027 1:31428925-31428947 GGGGTGGGGTGTCTCTGGTCTGG + Intronic
905892826 1:41527941-41527963 GGTGTGGGGTGCATGTGTGAGGG - Intronic
906104952 1:43286059-43286081 GGTGAGGGGTGGATCTGGATGGG + Intergenic
914999637 1:152577204-152577226 GGTGTGGGGTCCATGTGGCAAGG + Intronic
918478595 1:184952650-184952672 CCTGTGGGCTGCATGTGGCCCGG - Intronic
920159545 1:203985755-203985777 GGAGGGGCATGCATCTGGCCAGG + Intergenic
920279639 1:204832982-204833004 GATGTTGGATGCATATGGCCTGG + Intronic
923019879 1:230155091-230155113 GGTGGGGGGTGCATGCGGCGCGG - Intronic
924852178 1:247841506-247841528 GGAGTGGGCTGCAGATGGCCAGG + Exonic
1062967144 10:1616458-1616480 GGTGTGGAGTGTGTCTGGACGGG - Intronic
1062967224 10:1617010-1617032 GGTGTGGAGTGTGTCTGGACGGG - Intronic
1062967253 10:1617203-1617225 GGTGTGGAGTGTGTCTGGACGGG - Intronic
1062967267 10:1617295-1617317 GGTGTGGAGTGTGTCTGGACGGG - Intronic
1062967295 10:1617479-1617501 GGTGTGGAGTGTGTCTGGACGGG - Intronic
1062967319 10:1617663-1617685 GGTGTGGAGTGTGTCTGGACGGG - Intronic
1067046320 10:42987249-42987271 GGTGTGTGGTGGATCGGGCAGGG - Intergenic
1067177447 10:43960055-43960077 GCTCTGGGCTCCATCTGGCCGGG + Intergenic
1069438521 10:68407282-68407304 GCTGTGGGCTGCAGCGGGCCTGG - Intronic
1069683447 10:70301208-70301230 TGGGTGGGGTGCAGCTGGTCTGG - Exonic
1069797298 10:71061643-71061665 GGGGTGGGGTGGACCTGACCTGG - Intergenic
1069869933 10:71526952-71526974 AGTGTCGGGCGCATGTGGCCGGG + Intronic
1070438361 10:76415730-76415752 AGTGTGGGGAGCATATGGCATGG - Intronic
1070751962 10:78969165-78969187 GGTGGGAGGTGGGTCTGGCCAGG - Intergenic
1071599961 10:86954224-86954246 GATGTGGGGCTCCTCTGGCCTGG + Intronic
1072443244 10:95476114-95476136 GGGGTGGGGCTGATCTGGCCTGG - Intronic
1072789986 10:98311042-98311064 GGTGTGCGGGGCACCTTGCCAGG - Intergenic
1073434091 10:103505812-103505834 GGGCTGGGGTGACTCTGGCCAGG - Intronic
1074148903 10:110740909-110740931 GGTGTTGGATGCTTCTGTCCAGG + Intronic
1075153742 10:119957033-119957055 GGGGTGGGGTGCTTCTGGGAAGG + Intergenic
1076858293 10:133127990-133128012 GGTGTGGGGTGGGTGGGGCCAGG - Intronic
1076882365 10:133245783-133245805 GGGGTGGGGTGCTTCCGGCCGGG - Intergenic
1076885045 10:133258324-133258346 GCTGTGGTGTGTCTCTGGCCTGG + Intergenic
1077076766 11:705728-705750 CCTGAGGGGTGCACCTGGCCCGG + Intronic
1077134314 11:991031-991053 GGTGGGGGGAGCATCGTGCCCGG - Intronic
1077134807 11:993195-993217 GGTGTAGGGTGCACCGCGCCAGG + Intronic
1077253463 11:1570922-1570944 GGGGTGGGGTGCTGCAGGCCAGG - Intronic
1077421247 11:2451030-2451052 GGTGTGGGGTCCATCTGAGCAGG + Intronic
1077427336 11:2489310-2489332 GGTGTGGGCTGAATTTAGCCTGG - Intronic
1077517313 11:3009765-3009787 TGTCTGTGGAGCATCTGGCCTGG + Intronic
1077784895 11:5373436-5373458 GGTATGGGGTTCATCTCGCTAGG + Intronic
1079535855 11:21514684-21514706 TGTGTGGGCTGTTTCTGGCCAGG + Intronic
1081035334 11:38137124-38137146 AGTGTGGGGTGCATGTTGCTTGG - Intergenic
1081623749 11:44634644-44634666 GGTCTGGGGTGCTCCTGGCAGGG + Intergenic
1083479748 11:62936258-62936280 GGTCTTGGGTGGGTCTGGCCAGG + Intergenic
1083718440 11:64592167-64592189 GGTGCGGGGGGCACCTGGGCGGG + Intronic
1083990779 11:66244487-66244509 GCTGTGGGGCGCAGATGGCCGGG - Exonic
1084209610 11:67614965-67614987 GATCTGGGCAGCATCTGGCCAGG - Intergenic
1084678600 11:70651666-70651688 AGTGTGGGGTGTTTCTGTCCTGG - Intronic
1084907306 11:72358018-72358040 AGTGTGGGAAGCATCTGGCCAGG - Intronic
1090129925 11:124129708-124129730 GGTGGGGGGTGTATGTGTCCAGG + Intronic
1090334801 11:125955085-125955107 GGTGTTGGGTGCAGCAGGCACGG + Intergenic
1091314947 11:134608054-134608076 GGTCTGGGCTGCATAGGGCCTGG - Intergenic
1093201987 12:16199023-16199045 CGGGTGGAGTGCAGCTGGCCTGG - Intronic
1093218071 12:16386032-16386054 GGTGTGGGCTCCTTTTGGCCAGG + Intronic
1094742713 12:33308247-33308269 GGTGAGGGGTTCATCTGCACAGG - Intergenic
1096319664 12:50600506-50600528 TGGGTAGGGTGCACCTGGCCTGG + Intronic
1097744403 12:63285493-63285515 GTTTTGGGGTGCATCTGTGCAGG + Intergenic
1099397106 12:82154149-82154171 GTTGTGGGGTCCCTGTGGCCTGG - Intergenic
1101409989 12:104459300-104459322 GCTCTGGGGTGAGTCTGGCCCGG - Intronic
1102221467 12:111197758-111197780 GGTGGGAGGTGGATCTGACCTGG - Intronic
1102967689 12:117140946-117140968 GGTGTCGGGTGCATCCTGCCGGG - Intergenic
1103944489 12:124518437-124518459 GGTTTGGGGGGCATCGGGCTGGG - Intronic
1104140520 12:125983106-125983128 GATGTTGGGTGCAGCTGGGCAGG - Intergenic
1104713973 12:131004730-131004752 GGTGAGGGGTTCATCTGTTCAGG + Intronic
1104728875 12:131094283-131094305 GGGGTGGGGTGGAGCAGGCCTGG + Intronic
1105925242 13:25001978-25002000 TGTGTGCACTGCATCTGGCCAGG + Intergenic
1106459703 13:29958252-29958274 GGGGTGGGGCACATCTGTCCAGG - Intergenic
1106662471 13:31814438-31814460 GGGGTGCTGTGCAGCTGGCCTGG - Intergenic
1107863414 13:44682353-44682375 GGTGAGGGGCGCCTCTGCCCGGG - Intergenic
1107992677 13:45832082-45832104 GGTGTGGGGTGCAGCCACCCAGG + Intronic
1111238347 13:85439241-85439263 AGTGTTGGGTACATATGGCCAGG - Intergenic
1112657995 13:101473636-101473658 GATGTGGGATGCATGTGACCTGG + Intronic
1113597040 13:111540581-111540603 GGAGTGGGGGGCATGGGGCCGGG + Intergenic
1113849609 13:113410680-113410702 GGTGTGGGCGGCCTCTGGCTGGG - Intergenic
1113856975 13:113452129-113452151 TGTGTGGGGTGCACCTGTTCTGG + Intronic
1113871567 13:113563041-113563063 GGAGTGGGGTGTAACTGGGCAGG - Intergenic
1117474669 14:56081889-56081911 GGTTTGGTTAGCATCTGGCCTGG + Intergenic
1119883937 14:78124458-78124480 GGTGTGGGGTGCAAAGGTCCCGG + Intergenic
1121407614 14:93728513-93728535 CCTGTAGGGTGCAGCTGGCCGGG + Intronic
1121602028 14:95212467-95212489 GGTGTGGGGTGAAACAGGGCCGG + Intronic
1122875052 14:104660078-104660100 GCTGTGGGGTGCGTCTGGGTGGG - Intergenic
1122892380 14:104738774-104738796 GCTCTGCGGAGCATCTGGCCAGG + Intronic
1122953376 14:105058663-105058685 GGTGTGACGTGCACATGGCCTGG + Intronic
1123012935 14:105357965-105357987 GATGTGGGGGGCACCTGCCCAGG + Intronic
1123404553 15:20012075-20012097 GCTGTGGGGGGCATCTAGCATGG + Intergenic
1123513886 15:21018722-21018744 GCTGTGGGGGGCATCTAGCATGG + Intergenic
1128152462 15:65371877-65371899 GGTGTGGACTGAAGCTGGCCTGG - Intronic
1129320754 15:74773385-74773407 GGGGTGGGGTGGAACTGGGCTGG - Intergenic
1129653639 15:77508558-77508580 GGGGTGGGGTTCAGCAGGCCTGG - Intergenic
1129885671 15:79035550-79035572 GGTGTGGGGCCCAGCAGGCCGGG - Intronic
1130149704 15:81302044-81302066 GGTGTGGGGAGGAAGTGGCCAGG + Intronic
1130598709 15:85262610-85262632 GGGGTGGGGAGCGGCTGGCCTGG + Intergenic
1132338337 15:101063038-101063060 GCTGTGAGGTGGCTCTGGCCTGG - Intronic
1132595397 16:746811-746833 TGTGATGGGGGCATCTGGCCTGG - Intronic
1132606949 16:797539-797561 GGGGTGAGGGGCAGCTGGCCTGG + Intronic
1132678496 16:1130410-1130432 GGTCTGGGGTCCATCTGGCGAGG + Intergenic
1133352746 16:5112979-5113001 GGTGGGGTGTGGCTCTGGCCTGG + Intergenic
1135040965 16:19116006-19116028 GGGGTGGGGGGCACCTGGCAAGG - Exonic
1135984341 16:27173075-27173097 GGTGTGGGGACCCTCTTGCCTGG - Intergenic
1137666059 16:50249762-50249784 GAGGTGGTGGGCATCTGGCCAGG + Intronic
1138476009 16:57270996-57271018 GGGGTGGGGTGGCTGTGGCCTGG - Intronic
1138528396 16:57621710-57621732 GGTGTCAGGTGCCTCTGGTCAGG - Intronic
1140241053 16:73201095-73201117 GGTGTAGTGTCCAGCTGGCCTGG - Intergenic
1141096660 16:81167888-81167910 TGTGAGGTCTGCATCTGGCCTGG + Intergenic
1142582441 17:950452-950474 TGTGTGGGGTGCAAACGGCCGGG + Intronic
1143022269 17:3923004-3923026 GGTGTGAGGTGCATTTGAGCTGG + Intergenic
1145773704 17:27511592-27511614 GGAGTGGGATGCTTCTGGGCTGG + Intronic
1146259946 17:31414713-31414735 GCTTTGGAGTGCCTCTGGCCAGG - Intronic
1146957946 17:36947840-36947862 GCTGTGGGATCCAACTGGCCCGG + Intergenic
1147320825 17:39644951-39644973 GGTGTCTGGAGCTTCTGGCCTGG + Intronic
1147627264 17:41908212-41908234 GGCGTGGGCTGGCTCTGGCCAGG - Intronic
1148804219 17:50256182-50256204 GGTGAAGAGGGCATCTGGCCAGG - Intergenic
1148856082 17:50580015-50580037 GGGGAGGGGTGCACCTGGCCAGG - Intronic
1149596047 17:57865339-57865361 GGTGTGGGGGCCAGCTGCCCAGG + Intronic
1150904872 17:69326897-69326919 GGTGTGGGGTGAAGCGGGCTCGG - Intronic
1151743911 17:76001372-76001394 GGCGTGGGGTGCAAATTGCCCGG + Exonic
1151805036 17:76399949-76399971 GCTGTGAGGTGCACCTGGGCAGG + Intronic
1154313508 18:13285315-13285337 GGTGTGTGGTTCATTTGGCTTGG + Intronic
1154355742 18:13622181-13622203 GGTATGGGGTGCAGCTGTCCAGG + Intronic
1155259019 18:24023459-24023481 GGTGTCAGCTGCACCTGGCCTGG + Intronic
1156491458 18:37498763-37498785 GGAGAGGGTTGCACCTGGCCTGG + Intronic
1156927644 18:42601906-42601928 GGTCTGGTGGGCATCAGGCCCGG + Intergenic
1157288450 18:46393331-46393353 GGTGTGGGGTGCATCTGGCCAGG + Intronic
1158451950 18:57574622-57574644 GGAGTGGGGAGCTCCTGGCCTGG - Intronic
1160375483 18:78408792-78408814 CACGTGGGGTGCAGCTGGCCTGG - Intergenic
1160511597 18:79456267-79456289 AGTGTGGGGTGCATGTCCCCAGG + Intronic
1160583327 18:79899888-79899910 GGGGTGGGGGGCGTCTGGCCTGG + Intronic
1160716733 19:580139-580161 GGTGTGGGGTTCATCAGTCGGGG + Intronic
1161156519 19:2734663-2734685 GATGGGGGGTGCTCCTGGCCTGG - Intronic
1162131639 19:8529703-8529725 GTTGAGAGATGCATCTGGCCAGG + Intronic
1162420767 19:10565126-10565148 GGAGGGGGGTGGATCTGGCTGGG + Intronic
1162494787 19:11017647-11017669 GGTGTGCGGAGCATCTGCACTGG - Intronic
1163168662 19:15515427-15515449 GGTGTTCAGTGCAGCTGGCCAGG + Intronic
1163390891 19:17029051-17029073 TGGGTGGGGTGCAGCTGGTCTGG - Intergenic
1164731272 19:30506633-30506655 GGTGTGGGGTGCATGTGCGCTGG + Intronic
1165068344 19:33241511-33241533 GTTGGGGGGTGCATGTGGTCCGG + Intergenic
1166167759 19:41004195-41004217 GGTGGGGGGTGCATCAGGGAAGG + Intronic
1166252445 19:41580675-41580697 GGAGTGTGGTGCATCTGGGGAGG - Intronic
1166641095 19:44495797-44495819 GGTGAGGAGTGCATCTGCACAGG - Intronic
1167306673 19:48713830-48713852 GGTGTGGGTTGAATCCGGCTAGG - Intronic
1167409805 19:49338152-49338174 GGAGTGGGGAGCGTCGGGCCTGG - Intronic
1202712394 1_KI270714v1_random:25504-25526 GGTCTGGGTCACATCTGGCCGGG + Intergenic
925417578 2:3681814-3681836 GATGTGGGGAGCATCAGGGCTGG - Intronic
926822168 2:16864162-16864184 GGGGTGGGGGGCATTTTGCCTGG + Intergenic
926892400 2:17649727-17649749 GGCGTGGTGTGCAGCTGGCAGGG - Intronic
928071961 2:28225993-28226015 GCTGTGGGCTGGATTTGGCCAGG - Intronic
931189043 2:59981984-59982006 TGTGGGGAGTGCATCTGCCCTGG + Intergenic
931638454 2:64361366-64361388 GGTTTTGAGTGGATCTGGCCGGG - Intergenic
932356797 2:71073971-71073993 GCTGTGAGCTGCTTCTGGCCTGG + Intronic
932478714 2:72025175-72025197 GCTGTGGGATGGATTTGGCCTGG - Intergenic
932714759 2:74093160-74093182 GGTGTGGGATGCAGGTAGCCTGG - Intronic
933854484 2:86400032-86400054 GGTGTGGGGGGCAGCAGGACGGG + Intergenic
933897527 2:86825125-86825147 GGTGATGGGTGCATCTGCCTTGG + Intronic
936258141 2:110934894-110934916 GGCCTAGGGTGCAGCTGGCCAGG + Intronic
937696832 2:124817835-124817857 AGTGGTGGGTGAATCTGGCCTGG + Intronic
937919398 2:127119606-127119628 GGTGAGGGGCGCCTCTGCCCGGG - Intergenic
938536389 2:132252787-132252809 GGTGTGGGGTTCATTGGCCCTGG - Intronic
938649529 2:133367980-133368002 GTTCTGGGGGGCATCTGGCTGGG - Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
945143956 2:206716299-206716321 GGCCTGGGGTGGCTCTGGCCTGG - Intronic
946647188 2:221850441-221850463 GGTGTGATTTGCATCTGCCCTGG - Intergenic
946686686 2:222278272-222278294 GGTGGGGGAGGCTTCTGGCCAGG - Intronic
947528334 2:230893208-230893230 GGTGTGGGGGGCTTCGGGTCAGG - Intergenic
947650121 2:231780318-231780340 GGTGTGGGGTGCCTCGCGCTGGG - Intronic
1169118641 20:3082879-3082901 GGTGGGGGCTGCGTCGGGCCCGG - Intronic
1171865276 20:30484557-30484579 GGTGTGGGGTTCATTGGCCCTGG - Intergenic
1172484131 20:35288298-35288320 GGTGTCGGGGGCATCGGCCCTGG - Intronic
1173599214 20:44280808-44280830 GGGGTGGGGGGCATGTGCCCTGG - Intronic
1175263565 20:57689429-57689451 GGTGAGGGGTGACTCTGGCCTGG + Intronic
1175310933 20:58011198-58011220 GGTGGGGGGTGCATCTGGCTTGG - Intergenic
1175941630 20:62540009-62540031 GGTGAGGGCTGCATCTGCCATGG + Intergenic
1176302609 21:5105648-5105670 GGTGTGGGGTGAATCTCTGCTGG + Intergenic
1176302617 21:5105677-5105699 GGTGTGGGGTGAATCTCTGCTGG + Intergenic
1179548128 21:42125711-42125733 GGTGAGAGGTGCATGTGGGCCGG + Intronic
1179854408 21:44156246-44156268 GGTGTGGGGTGAATCTCTGCTGG - Intergenic
1179854416 21:44156275-44156297 GGTGTGGGGTGAATCTCTGCTGG - Intergenic
1179854432 21:44156333-44156355 GGTGTGGGGTGAATCTCTGCTGG - Intergenic
1179938214 21:44618639-44618661 GGTGTGGGGTGCTGCTGCCAGGG + Intronic
1181537308 22:23553162-23553184 GGTGTGGAGTGTATCAGGGCAGG - Intergenic
1182478893 22:30593578-30593600 GGTGTCGTGAGCATGTGGCCTGG + Intronic
1184663390 22:45975813-45975835 GGGGTGCGGTGCACCTCGCCTGG - Intronic
1185275435 22:49948527-49948549 GGTGGGGGGTGTTGCTGGCCAGG + Intergenic
950493901 3:13322370-13322392 GGTGTGGTGGCCATCGGGCCTGG - Intronic
954106697 3:48413401-48413423 GTTGTGGGATGGATTTGGCCTGG - Intronic
954447822 3:50555986-50556008 GCTGAGGGGTGCAGCTGGGCAGG + Intergenic
958407123 3:93764306-93764328 GGTGAGGGGTGTCTCTGCCCGGG - Intergenic
959670662 3:108973465-108973487 GGTGTATGGTGCAGGTGGCCTGG - Intronic
960994021 3:123329394-123329416 GATATGTGGTGCATGTGGCCGGG - Intronic
961598846 3:128043127-128043149 GGTGCCTGGAGCATCTGGCCAGG - Intergenic
964123292 3:153209039-153209061 GGTGTGGGGTTCCTCTGGGAAGG - Intergenic
968444918 4:647330-647352 GATTTGGGGTCCATCTGGCCGGG + Intronic
968969629 4:3786819-3786841 GGCCTGGGGTGAAGCTGGCCTGG - Intergenic
969723418 4:8905904-8905926 GGTCTTGGGTGCCTGTGGCCGGG - Intergenic
972695239 4:41438990-41439012 GGTGAGGGGAGCATCTGTCAGGG + Intronic
980562965 4:134501920-134501942 GGTGGGGGGAGCCTCGGGCCAGG - Intergenic
980964410 4:139506978-139507000 GGAGAGGGGAGCATCTGGCAAGG - Exonic
983743863 4:171169671-171169693 GATGTGGGCTGCATGTGGCAGGG + Intergenic
985539694 5:482213-482235 TCTGTGTGGTGCACCTGGCCGGG - Intronic
985711345 5:1431537-1431559 AGTGTGGGTTGGGTCTGGCCGGG + Intronic
985711357 5:1431566-1431588 GGTGAGGGGTGGGCCTGGCCGGG + Intronic
989580749 5:43030924-43030946 CCTCTGGGGTGCATCAGGCCTGG + Intergenic
990154225 5:52856509-52856531 GAGGTGGGTTGCAGCTGGCCAGG - Intronic
997676824 5:135719514-135719536 GGTGTAGGGAGCATCTCTCCTGG - Intergenic
998372775 5:141672016-141672038 GGTGTGAGGGGCATGTGGCACGG + Intronic
998401992 5:141852988-141853010 GCTGTGGGGGGCAGCTGGACAGG - Intergenic
998444216 5:142186220-142186242 TGTGTGGTGTGCATCTTTCCAGG + Intergenic
1003570355 6:7252520-7252542 GGTGTTGGGTGCACAGGGCCAGG + Intergenic
1004138205 6:12989515-12989537 GGGGTGAGGTGCTTCTGGCCTGG - Intronic
1004414829 6:15415541-15415563 GGTGAGGGGCGCCTCTGCCCGGG - Intronic
1005416371 6:25604534-25604556 GGTGAGAGGTGCATGGGGCCAGG - Intronic
1006378567 6:33684943-33684965 GGTGTGGGGGGCCTGGGGCCTGG + Exonic
1007585456 6:42986299-42986321 GGTGGGGGTTGGCTCTGGCCTGG + Intronic
1011588167 6:88947646-88947668 GGTGAGGGGCGCCTCGGGCCCGG + Intronic
1013426625 6:110018317-110018339 GGTGTCAGGTGCATCTGCCACGG + Intergenic
1013594949 6:111651987-111652009 GGTTTGGGTTGTATCTGCCCAGG + Intergenic
1016923582 6:149318228-149318250 GGGGTGGGGAGCATCGGGCCGGG + Intronic
1019160026 6:170063385-170063407 GGTGGGAGATGCATGTGGCCAGG - Intergenic
1019339436 7:501837-501859 GTTCTGGGGTGCAGGTGGCCAGG + Intronic
1019427382 7:983989-984011 GGGCTGGGGTGCTGCTGGCCGGG + Intronic
1019599654 7:1874902-1874924 GGTGCAGGGTGCCTATGGCCAGG - Intronic
1021450802 7:20782930-20782952 GGTGTGAGGTGCAGTTGTCCAGG - Intronic
1029487587 7:100852866-100852888 GCTGTGGGGTGCACCTGGCCGGG + Intronic
1032471878 7:132184711-132184733 GGTGTTCAGTGCATCTGGCTGGG + Intronic
1033330302 7:140411879-140411901 GGTGTGGGACACAGCTGGCCAGG + Exonic
1033945344 7:146709780-146709802 GGTGTGGGGTGTATCTTGAGAGG + Intronic
1035124816 7:156600947-156600969 GATGTGGGCTGCTGCTGGCCTGG - Intergenic
1035728411 8:1838934-1838956 GGTGTGGGGGCCATCTGGCATGG + Intronic
1035728423 8:1838982-1839004 GGCGTGGGGGCCATCTGGCGTGG + Intronic
1037886496 8:22598982-22599004 GGTGGGGGGCGCAGGTGGCCGGG - Intronic
1040831291 8:51680243-51680265 GATGTGGGGTGCATGTGGCTTGG + Intronic
1043388323 8:79768556-79768578 CGTGCCGGGTGCACCTGGCCGGG + Intergenic
1047248640 8:123165565-123165587 ACTGTGGGCTGCATCTGGCCTGG + Intergenic
1049163597 8:141112741-141112763 GCTGTGGGGTGCCTCTGATCAGG + Intergenic
1049978073 9:878611-878633 GGGCTGGGCTGCACCTGGCCAGG - Intronic
1050442532 9:5680573-5680595 GGTGTAGGGTGTATGTGTCCAGG + Intronic
1053048205 9:34937067-34937089 GGTGAGGGGCGCCTCTGCCCCGG + Intergenic
1055326161 9:75132273-75132295 GGTGTGGTGAGCATTTGGCCAGG + Intronic
1055376785 9:75657373-75657395 GATGTGGGCTGCCTCTGGACTGG - Intergenic
1060970022 9:127732517-127732539 GGTGTGGGGTGAAGCTGCCCGGG + Intronic
1061368770 9:130186321-130186343 GGTCTGGGGTGCATCTGGGAGGG + Intronic
1061888436 9:133605142-133605164 TGCGTGGGGTGGAGCTGGCCTGG + Intergenic
1062089449 9:134667489-134667511 GGTGTGGGGTGGTGCTGGCAGGG - Intronic
1062138319 9:134941560-134941582 GGGGTGGGGTCCACCTTGCCTGG - Intergenic
1062268103 9:135696573-135696595 CATGTGGGGTGCCTTTGGCCTGG - Intronic
1203769485 EBV:41575-41597 GCTGTTGGGTGCATCTGGAACGG + Intergenic
1186664366 X:11703203-11703225 GGTGTGTGGCACAACTGGCCAGG - Intergenic
1187183539 X:16964987-16965009 GGTGAGGGGCGCCTCTGCCCGGG - Intronic
1187507311 X:19887871-19887893 GGAGAGGGGTGCCTCTGGCGCGG - Intergenic
1192268374 X:69555904-69555926 GGGGTGGGGTGGGTCTGGGCAGG + Intergenic
1195229614 X:102832676-102832698 GGTGTGAGGTGTCTCTGGCAGGG + Intergenic
1197400449 X:125982814-125982836 GGTGTGGGGTCCATTTTGTCAGG - Intergenic
1199604798 X:149568672-149568694 GCTGTGAGCTGCATCTGGCTTGG - Intergenic
1201177267 Y:11316521-11316543 GGGGTGGGGTGGGTCTGGTCAGG - Intergenic