ID: 1157292573

View in Genome Browser
Species Human (GRCh38)
Location 18:46420388-46420410
Sequence GCCCGGCCCTGTGAATACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157292573_1157292577 20 Left 1157292573 18:46420388-46420410 CCACCGTATTCACAGGGCCGGGC 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1157292577 18:46420431-46420453 TTCTGCACACCTCAATAGGAAGG 0: 1
1: 0
2: 1
3: 4
4: 76
1157292573_1157292576 16 Left 1157292573 18:46420388-46420410 CCACCGTATTCACAGGGCCGGGC 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1157292576 18:46420427-46420449 TGTGTTCTGCACACCTCAATAGG 0: 1
1: 0
2: 0
3: 15
4: 130
1157292573_1157292578 21 Left 1157292573 18:46420388-46420410 CCACCGTATTCACAGGGCCGGGC 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1157292578 18:46420432-46420454 TCTGCACACCTCAATAGGAAGGG 0: 1
1: 0
2: 1
3: 5
4: 114
1157292573_1157292579 22 Left 1157292573 18:46420388-46420410 CCACCGTATTCACAGGGCCGGGC 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1157292579 18:46420433-46420455 CTGCACACCTCAATAGGAAGGGG 0: 1
1: 0
2: 1
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157292573 Original CRISPR GCCCGGCCCTGTGAATACGG TGG (reversed) Intronic
900189498 1:1347332-1347354 GCCCGGGCCTGGGAACAGGGTGG - Intronic
902181011 1:14688373-14688395 GCCTGGCACAGGGAATACGGTGG - Intronic
902946838 1:19846923-19846945 GCCTTGCCCTGTGCATACGAGGG + Intergenic
915396057 1:155585129-155585151 ACCAGGCCCTGTGAATACAATGG - Intergenic
921816433 1:219569229-219569251 GCCTGGACCTGTGAATGTGGAGG - Intergenic
1064033563 10:11898544-11898566 GCCCAGCCCTGTGATTACAGTGG - Intergenic
1065861527 10:29876340-29876362 GCCAGGCCCTGTGGAGATGGTGG - Intergenic
1067283639 10:44891538-44891560 GCCAGGCCCTGAGAACACTGGGG + Intergenic
1067495513 10:46757180-46757202 CACCGGCCCTGGGAATACTGCGG - Intergenic
1067599140 10:47583208-47583230 CACCGGCCCTGGGAATACTGCGG + Intergenic
1067948801 10:50709793-50709815 CACCGGCCCTGGGAATACTGCGG + Intergenic
1071276157 10:84057377-84057399 GCCAGGCCCTGAGAATACTATGG + Intergenic
1076872369 10:133200302-133200324 GCCCCGCCCTGTGGAGACTGTGG + Intronic
1084118772 11:67056890-67056912 GCCCGGCCCCGGGATGACGGCGG + Exonic
1090537294 11:127657576-127657598 TCCCAGCCCTGTGACTCCGGGGG + Intergenic
1092757275 12:11775532-11775554 GCTAGGCACTGTGAATACCGTGG + Intronic
1101910447 12:108857291-108857313 GCCCGGCTCTGTTCCTACGGCGG + Intronic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1120641684 14:87020959-87020981 GCCCGGCGCTCGGCATACGGAGG - Intergenic
1122122295 14:99561017-99561039 GCCCTGCCCTGTGGAGACTGAGG - Intronic
1129753937 15:78084572-78084594 GCCAGGCCCTGGGAACAGGGTGG - Intronic
1129829795 15:78661261-78661283 GCCCCGCCCTGAGGATGCGGCGG + Intronic
1130984094 15:88833476-88833498 GCACGGCCCTGTCAACAGGGAGG - Intronic
1132353347 15:101154304-101154326 CCCCTGCCCCGTGACTACGGAGG + Intergenic
1133968295 16:10547611-10547633 GCCCTGCCCTGTGAAAATGTTGG - Exonic
1137960989 16:52882042-52882064 GCTAGGCGCTGTGAATACAGTGG - Intergenic
1138216300 16:55207841-55207863 GCCCAGCCTTGTGATGACGGGGG - Intergenic
1139613477 16:68075185-68075207 GCCCAGCCCTGGGATTACTGTGG - Intronic
1141154564 16:81588148-81588170 GCCCAGCCCTGGGGATCCGGAGG - Intronic
1141441191 16:84030720-84030742 ACCTGGCCCTGTGAATTCTGTGG - Intronic
1142610031 17:1104018-1104040 GCCAGGCACTGGGAATACGAAGG + Intronic
1147786294 17:42980790-42980812 GTCCGGCCCGGCGAATCCGGCGG - Exonic
1148149411 17:45387618-45387640 GCCAGGCACTGTGCATACGATGG + Intergenic
1148763847 17:50026216-50026238 GCCCGGACCTGTGAAAAGGAGGG + Intergenic
1151674278 17:75589698-75589720 GCCCTGCCCTGTGGATCCTGGGG - Intergenic
1157292573 18:46420388-46420410 GCCCGGCCCTGTGAATACGGTGG - Intronic
1160568862 18:79803217-79803239 GCCCTGCCCTGTGACTACAGAGG - Intergenic
1160568878 18:79803274-79803296 GCCCTGCCCTGTGACTACAGAGG - Intergenic
1163756021 19:19106493-19106515 GGCCTGCCCTGTGGACACGGAGG - Intronic
1164416335 19:28049119-28049141 GCCCAGCACTGTGATTACAGAGG - Intergenic
1167880216 19:52451389-52451411 GCCCGGCCCTGAGAGTCCCGTGG - Intronic
925920085 2:8632395-8632417 GCAAGACACTGTGAATACGGAGG + Intergenic
926154773 2:10447886-10447908 GCCCCGAGCTGTGAAGACGGGGG + Intronic
933063397 2:77767347-77767369 GCCCGGCCCTGTGAAGGTGGAGG - Intergenic
938703857 2:133902708-133902730 GCTAGGCCCTGTGAATATGATGG - Intergenic
1168809385 20:694313-694335 ACCCTGCGCTGTGAATATGGTGG - Intergenic
1169171840 20:3471411-3471433 GACCGGCCCTGTGTCAACGGCGG + Exonic
1174386127 20:50189600-50189622 TCCCTGCCCTGTGCTTACGGTGG - Intergenic
1175768322 20:61606509-61606531 GCCCTGTCCTGTGAACACAGAGG + Intronic
1176309604 21:5142661-5142683 GCCCAGGCCTGTGCACACGGGGG + Exonic
1179847456 21:44119372-44119394 GCCCAGGCCTGTGCACACGGGGG - Exonic
1180833441 22:18918275-18918297 GCCCTGCCCTGAGAAGACAGAGG + Intronic
1181066385 22:20307980-20308002 GCCCTGCCCTGAGAAGACAGAGG - Intergenic
1181571231 22:23768591-23768613 GGCCGGCCCGGGGAATCCGGTGG - Intronic
1182265952 22:29115557-29115579 TCCAGGCCCTGGGAATACAGGGG + Intronic
1185000080 22:48240000-48240022 TCCAGGCCCTGTGAATGTGGAGG + Intergenic
1203283526 22_KI270734v1_random:143573-143595 GCCCTGCCCTGAGAAGACAGAGG + Intergenic
956033029 3:65060166-65060188 GCCTGGCCCTGGGAATACAGTGG + Intergenic
957899749 3:86473949-86473971 GCCAGGCCCCATGAATACTGGGG - Intergenic
961018302 3:123483753-123483775 GCTGGGCCCTGAGAATACAGTGG + Intergenic
968957598 4:3727134-3727156 GCCCCTCCCTGTGAGTATGGGGG - Intergenic
970431648 4:15994486-15994508 GCTCGGCCCTGGAAATACAGAGG - Intronic
985488983 5:168067-168089 GCCCTGCCCTGGGGATACGGAGG + Intronic
995857648 5:116610402-116610424 GGGCGGCACTGTGAATACCGTGG + Intergenic
997521113 5:134525334-134525356 GCCCGGCCCTGGGGACAGGGCGG + Intronic
999751261 5:154629670-154629692 GCCTGGCCCTGTGAACACTGTGG - Intergenic
1002024666 5:176388828-176388850 TCCCGGCCCTGTGATTCCGGAGG + Exonic
1002066338 5:176653847-176653869 GCCAGGCCCTGAGGATTCGGCGG + Intronic
1015450354 6:133360609-133360631 GCCAGTCTCTGTGAATACAGTGG + Intronic
1016958320 6:149648415-149648437 GCCCGGCCCTGGAAAATCGGGGG + Intronic
1019326123 7:439082-439104 GCCCGGCCGAGTGGACACGGGGG - Intergenic
1020016293 7:4834033-4834055 CCCCGGCCCTGTGGACACTGTGG - Intronic
1023513645 7:40979057-40979079 GCCAGGGACTGTGAATATGGGGG - Intergenic
1034210632 7:149359128-149359150 GCCTGGCCATGTGAGGACGGGGG + Intergenic
1034430679 7:151039846-151039868 GCTCGGCCCTGAGGATGCGGAGG - Intronic
1039360552 8:36872426-36872448 GCCCCGCCCTGTAACTATGGTGG + Intronic
1049006469 8:139858806-139858828 GACCGGGACTGTGAATCCGGGGG + Intronic
1051620911 9:19049005-19049027 GCCCGGCCCAGTGAGTACAAGGG - Intronic
1060965229 9:127708679-127708701 GCCAAGCCCTGGGAATACAGAGG + Intronic
1193732872 X:85122548-85122570 GCCAGGCTCTGGGAATACAGTGG - Intergenic
1195319155 X:103707215-103707237 ACCAGGCTCTGTGAATAGGGTGG - Exonic
1198310092 X:135421991-135422013 GCTCGGCCTTGGGAACACGGGGG + Intergenic
1199563112 X:149185402-149185424 GTCTGGCCCTGTGAAAACAGAGG - Intergenic