ID: 1157294987

View in Genome Browser
Species Human (GRCh38)
Location 18:46435822-46435844
Sequence CCCACCCAGCACTGCCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157294987_1157294992 16 Left 1157294987 18:46435822-46435844 CCAGCAAGGCAGTGCTGGGTGGG 0: 1
1: 0
2: 3
3: 26
4: 327
Right 1157294992 18:46435861-46435883 AGGCTTACATTGCATCTTGAAGG 0: 1
1: 0
2: 0
3: 8
4: 121
1157294987_1157294991 -4 Left 1157294987 18:46435822-46435844 CCAGCAAGGCAGTGCTGGGTGGG 0: 1
1: 0
2: 3
3: 26
4: 327
Right 1157294991 18:46435841-46435863 TGGGGTGGCTGTGTAAACACAGG 0: 1
1: 0
2: 0
3: 12
4: 182
1157294987_1157294994 23 Left 1157294987 18:46435822-46435844 CCAGCAAGGCAGTGCTGGGTGGG 0: 1
1: 0
2: 3
3: 26
4: 327
Right 1157294994 18:46435868-46435890 CATTGCATCTTGAAGGATGGAGG 0: 1
1: 0
2: 1
3: 13
4: 141
1157294987_1157294993 20 Left 1157294987 18:46435822-46435844 CCAGCAAGGCAGTGCTGGGTGGG 0: 1
1: 0
2: 3
3: 26
4: 327
Right 1157294993 18:46435865-46435887 TTACATTGCATCTTGAAGGATGG 0: 1
1: 0
2: 2
3: 25
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157294987 Original CRISPR CCCACCCAGCACTGCCTTGC TGG (reversed) Intronic
900218680 1:1495674-1495696 CCCTCCTACCCCTGCCTTGCCGG + Exonic
900226035 1:1534115-1534137 CCCTCCCACCCCTGCCTTGCCGG + Exonic
901198730 1:7454713-7454735 CCCGCCCAGCACTGCTGTCCAGG - Intronic
901447697 1:9318284-9318306 CCCACCCACGCCTCCCTTGCTGG + Intronic
901880800 1:12192683-12192705 CCCACCCAGTCCTGCCTTCCAGG - Intronic
902287173 1:15414161-15414183 CCCGCCTAGCACAGCCTTGCAGG + Intronic
902837136 1:19054442-19054464 GCCACACAGCACTGCCTCGTGGG + Intergenic
903185124 1:21624554-21624576 TCAGCCCAGCACTGGCTTGCTGG + Intronic
903325200 1:22565331-22565353 CCCACCCGGCCCTGCTCTGCCGG - Intronic
903742582 1:25566826-25566848 CTCACACAGCTCTGCCTTCCAGG + Exonic
904027481 1:27513756-27513778 CTCCCCCAGCAGTGCCTGGCAGG - Intergenic
904058226 1:27686246-27686268 GCCACCCAACACTGTCTTGGTGG - Intergenic
904425163 1:30418134-30418156 CCAACCCAGCTCTGCCTGGCTGG - Intergenic
904769348 1:32872208-32872230 CCCACCCAGGACTCCTTCGCTGG + Intronic
905183299 1:36179327-36179349 CACGCCCAGCACTGCCCTTCGGG - Intronic
905394212 1:37656963-37656985 CCCTGGCAGCCCTGCCTTGCAGG + Intergenic
905540635 1:38757659-38757681 CCACCCAAGCACTGCCTTGTGGG - Intergenic
905704605 1:40045418-40045440 CCCACCCAGAAATTCCTTGAAGG - Intronic
905747680 1:40433170-40433192 CCAACCCATCCCTGCCTGGCAGG + Intergenic
905824370 1:41017541-41017563 CTGCCCCAGCACTGCCTGGCAGG + Intronic
906106132 1:43293769-43293791 CCCTCCCAGCCCTGCCTGCCTGG + Intergenic
906662197 1:47590816-47590838 CCCACCCTGCCCTGCCCAGCAGG - Intergenic
907038383 1:51236505-51236527 CCCCCCCATCGCTGCCTCGCAGG + Exonic
907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG + Intergenic
908394898 1:63716426-63716448 CCCAGCCAGGACAGGCTTGCAGG - Intergenic
911156986 1:94646651-94646673 CTCACCATGCACTGCCTTGCAGG - Intergenic
911523661 1:98959233-98959255 CAGACCAAGAACTGCCTTGCTGG + Intronic
912457641 1:109808499-109808521 CCCACCCAGCAGAGCATTCCTGG + Intergenic
912890140 1:113521479-113521501 CTCACTCAGCTCTGCCTTCCGGG + Intronic
917305416 1:173619100-173619122 CACCACCAGCCCTGCCTTGCAGG + Intronic
919781256 1:201222651-201222673 CCCCTCCAGCCCTACCTTGCTGG + Intronic
920859851 1:209696877-209696899 CATACCCAGCACAGCCTGGCAGG + Intronic
921653871 1:217711292-217711314 CCCACCCCGCACTGCCAAGTAGG + Intronic
922702243 1:227768640-227768662 CACACACAGCACTGCCTGGTAGG + Intronic
922767658 1:228164274-228164296 CCAAGCCATCCCTGCCTTGCTGG - Intergenic
923098492 1:230793994-230794016 GGCAGCCAGCACTGCCGTGCAGG + Intronic
923394083 1:233543516-233543538 GTGACCCAGCACTGCCTTGCAGG - Intergenic
1063187895 10:3666764-3666786 CCCACCCAGCTTTGCACTGCAGG + Intergenic
1063541834 10:6941829-6941851 CCCACCTATCACTTCCCTGCAGG + Intergenic
1065166279 10:22981716-22981738 CTCACCCAGCACTGACTTGTGGG + Intronic
1067233001 10:44425193-44425215 CGCATCCACCACTGCCTTGGTGG + Intergenic
1069030918 10:63595293-63595315 CCCACTCAGCACTAGCTTCCTGG + Intronic
1069567720 10:69474716-69474738 CCCACCCAGCTCTTCATTCCTGG + Intronic
1069884586 10:71615742-71615764 CTCACCCTGCACTGCCTCCCGGG + Intronic
1070151951 10:73810975-73810997 CCCACCCCGCCCAGCCCTGCTGG - Intronic
1070956648 10:80468183-80468205 CCAAACCAGCACTGCCTACCAGG + Intronic
1072206077 10:93206462-93206484 CCAACCCAGCCCTCCCTAGCAGG + Intergenic
1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG + Intronic
1073860410 10:107732211-107732233 ACCACCCCCCACTGCTTTGCTGG - Intergenic
1075093854 10:119458492-119458514 CCCTCCGAGCAATGCCTTTCAGG - Intronic
1076007024 10:126956025-126956047 CCATCCCAGCACAGCCTTGGAGG - Intronic
1076020961 10:127072761-127072783 TCCTCCCAGCACTGCCATGGTGG + Intronic
1076109205 10:127848425-127848447 GGCACCCAGCACACCCTTGCGGG - Intergenic
1076307499 10:129475317-129475339 CACACACAGCCCTGCCCTGCTGG - Intronic
1077325596 11:1962642-1962664 CCCACCCAGCTCAGCCTGTCAGG + Intronic
1077339467 11:2019599-2019621 CCCACCCTGCTCTGGCTTGGTGG - Intergenic
1077676743 11:4201400-4201422 CCCACCCTGCACTTTCTGGCGGG + Intergenic
1078846439 11:15122993-15123015 CCTACCCAGCACTCCCTCCCTGG + Intronic
1079677168 11:23243608-23243630 CCCATGCAGCAGTGCCTGGCAGG + Intergenic
1082658040 11:55874567-55874589 CCCAGCCAGCAGTACCATGCCGG + Intergenic
1083191070 11:61052819-61052841 CCCACCCAGACCTGCCTCTCTGG + Intergenic
1084030240 11:66476659-66476681 CCCACCCACCACTCACTTGGGGG - Exonic
1084268968 11:68019148-68019170 CTCTCCCTGCACTGCCCTGCAGG + Exonic
1084514440 11:69628668-69628690 CACAGCCAGCAAGGCCTTGCAGG - Intergenic
1084774073 11:71364171-71364193 GCCAGACAGCCCTGCCTTGCTGG + Intergenic
1084913758 11:72412069-72412091 CCCTCCCAGCCCTGGCTGGCAGG - Intronic
1085023298 11:73222263-73222285 GCCACCCAGCCCTGGCTTGTAGG + Intronic
1087907024 11:103710081-103710103 CCCACCCAGCTCTGCCAGGAAGG + Intergenic
1089335154 11:117717856-117717878 CCATCCCAGCATTGCCTCGCTGG - Intronic
1089350976 11:117821606-117821628 GCCACCCGGCACTGCCCTCCGGG + Intronic
1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG + Intronic
1090061484 11:123467760-123467782 CACATCCAGCACGGCCTAGCAGG + Intergenic
1202808576 11_KI270721v1_random:17821-17843 CCCACCCAGCTCAGCCTGTCAGG + Intergenic
1202822452 11_KI270721v1_random:74788-74810 CCCACCCTGCTCTGGCTTGGTGG - Intergenic
1091917229 12:4278450-4278472 CCCTCCCAACCCTGACTTGCAGG - Intronic
1091980163 12:4858243-4858265 CCAGCCCAGCCCTCCCTTGCTGG - Intergenic
1092025084 12:5233169-5233191 CCCACCCAGGGATGCCCTGCAGG - Intergenic
1092160606 12:6313422-6313444 CCCACTCAGCTTAGCCTTGCCGG + Intronic
1095986958 12:48005123-48005145 CCCATCCAGCTCTGCGTTGAAGG + Intergenic
1096652737 12:53069843-53069865 CCCACCCAGTTCTGCAATGCTGG - Intronic
1098183303 12:67870378-67870400 CCCACCAAGAACAGCTTTGCAGG + Intergenic
1098798870 12:74927297-74927319 CCCACCCTGCACCCCCTTGTAGG - Intergenic
1101900745 12:108789546-108789568 CCCACCCTTCACTTCCTTACAGG + Intronic
1103369636 12:120409033-120409055 CCCACCCTGCACTGAATTCCTGG + Intergenic
1103573973 12:121863277-121863299 CCCAGCCAGCTCTGCATTTCTGG + Intronic
1103593005 12:122005575-122005597 CACACCCAGCCCAGCCTGGCAGG + Intergenic
1105661170 13:22497016-22497038 CCCACCCAGCGCGGCCTGGCAGG + Intergenic
1105765495 13:23554657-23554679 TCCACCCACCTCTGCCTTCCAGG - Intergenic
1106709535 13:32315405-32315427 CCCACCCAGGCCTGACTTCCGGG + Intergenic
1111395367 13:87661246-87661268 CCCACCCAGTACTGCTTTCTGGG + Intergenic
1113861379 13:113489979-113490001 CACACCCAGCAGCACCTTGCTGG + Intronic
1114269065 14:21090548-21090570 CCCCCCCAGCCCTGCCTCTCCGG + Exonic
1114454841 14:22847673-22847695 CCGACCCAGCCCCGCCCTGCAGG - Exonic
1114626912 14:24136163-24136185 CGCACCCAGCTCCGCCTTCCTGG - Intronic
1115346452 14:32348102-32348124 CCCACCCAGCTGTGTCTTCCAGG - Intronic
1115784347 14:36807303-36807325 TCCACCCAGCATTGCCAAGCTGG - Intronic
1118155557 14:63237944-63237966 CCCACCCTGCTCTGTCCTGCTGG + Intronic
1118310479 14:64688824-64688846 CCTCCCCAACACAGCCTTGCAGG - Intergenic
1119390309 14:74287135-74287157 CCCACCAAGCTGTGCCTGGCAGG - Intronic
1119488825 14:75012214-75012236 ACCTCCCACCCCTGCCTTGCTGG + Exonic
1119716549 14:76863621-76863643 CCCACACAGCCCTGCCCTGGAGG - Intronic
1121176900 14:91897269-91897291 CCCACCGAGCACAGCCTCCCAGG + Intronic
1121446868 14:93984244-93984266 CACTCCCAGCACAGACTTGCTGG + Intergenic
1121494585 14:94383241-94383263 CCCCCCCATCTCTGTCTTGCAGG - Exonic
1122205416 14:100145734-100145756 CCAACCCAGCCCTGCCCTCCAGG + Exonic
1122235035 14:100326529-100326551 TCCACCCAACACTGCCTTCAAGG - Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122838600 14:104443486-104443508 CCCACCCAGCAGGGCTCTGCAGG + Intergenic
1122842897 14:104475426-104475448 CCCAGGCGGCCCTGCCTTGCGGG - Intronic
1122899155 14:104775003-104775025 CTCACCCAGCCCTGCTTTACAGG - Exonic
1125265439 15:37874417-37874439 CCCAAACATCACTGCCTAGCTGG + Intergenic
1129942827 15:79513000-79513022 CCCACCTCACACTGCCTTGGAGG + Intergenic
1132603203 16:782989-783011 CCCCCACAGGACTGCCTGGCGGG - Intronic
1132648382 16:1009583-1009605 GCCAACCAGCCCTGCCTCGCTGG - Intergenic
1132827731 16:1913475-1913497 CTCACCCTGCACTACCTGGCTGG - Intronic
1133006344 16:2883635-2883657 CGCGCCCAGCGCTGCCTTCCCGG + Intronic
1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG + Intronic
1134205317 16:12232884-12232906 CCCACCCAGCATGGGCTTGGAGG + Intronic
1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG + Exonic
1138098465 16:54232181-54232203 CCCATCCATCCCTGCCTTGGAGG - Intergenic
1138465192 16:57185413-57185435 CCCATCCTGCACTGCCATTCTGG + Intronic
1139138262 16:64231668-64231690 CCCACCTGTCACTTCCTTGCAGG - Intergenic
1139957262 16:70699009-70699031 GCCTCCCAGCACTGCCTACCTGG + Intronic
1140192632 16:72830943-72830965 CAGACCCAGTACTTCCTTGCTGG - Intronic
1140892720 16:79298782-79298804 GACACCCAGCAGGGCCTTGCAGG + Intergenic
1140899914 16:79358033-79358055 GCCACCAAGCAGTACCTTGCAGG + Intergenic
1141604260 16:85144025-85144047 CCCGCACGGCACTCCCTTGCTGG - Intergenic
1141750949 16:85957477-85957499 CCCACCCACCGCTGCTTGGCTGG + Intergenic
1141770224 16:86085345-86085367 CCCACTGGGCACTGCCCTGCAGG + Intergenic
1141842317 16:86580999-86581021 CCCTCCCAGCCCTGCCAGGCAGG + Exonic
1143915284 17:10287410-10287432 GCCACCGCGCCCTGCCTTGCTGG + Intergenic
1144701669 17:17344630-17344652 CCCTCCCAGCACTGACTGCCTGG + Intronic
1145395460 17:22490619-22490641 CCCACCCACCCCAGCCTGGCTGG - Intergenic
1146143304 17:30388394-30388416 GCGACTCAGCACTGGCTTGCAGG - Intronic
1147853970 17:43464513-43464535 CCCACCTAGTCCTGCCTTCCTGG - Intergenic
1148610430 17:48961158-48961180 CCCACCCAGCGCTGCCTGCCTGG + Intronic
1149458900 17:56811400-56811422 CCCACCCAGCTGTGGCTTGAAGG - Intronic
1149784103 17:59421146-59421168 CCCACCCACCCCAGACTTGCAGG + Intergenic
1150250633 17:63702404-63702426 CCCGCCCATCCCTGCCATGCTGG - Intergenic
1150666106 17:67139979-67140001 CCCACATAGCTCTGCATTGCAGG + Intronic
1150750715 17:67859430-67859452 GCCACCATGCCCTGCCTTGCAGG + Intronic
1150984236 17:70177315-70177337 CCTGGCCAGCACTGCCTAGCAGG - Exonic
1151310709 17:73291001-73291023 ACCACCCAGCACATCCTTGCGGG + Intronic
1151558857 17:74860444-74860466 CTCACCCAGCAGCTCCTTGCAGG + Intronic
1151730966 17:75910806-75910828 CCCATCCAAACCTGCCTTGCAGG - Exonic
1152740227 17:82015485-82015507 CCCAACCAGCACTGCCCCACGGG - Intronic
1153992550 18:10413203-10413225 CCCACACAGTAATGCCTTGCAGG - Intergenic
1157260044 18:46169630-46169652 ACCCCCCAGTACTCCCTTGCAGG - Intergenic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1157812999 18:50711000-50711022 CCCACCCAGCACGGGCTTGCTGG + Intronic
1159502126 18:69286788-69286810 CCCTCCCAGCACTGCCATGTTGG + Intergenic
1160155623 18:76431957-76431979 CCCGCCCACCACTGCCCTGGCGG + Intronic
1160237627 18:77098730-77098752 CCCACTCTGCCCTGCCTTGGCGG - Intronic
1161078065 19:2296095-2296117 CCCTCCCAGCACTGTTTTTCTGG + Intronic
1161848282 19:6724888-6724910 CCCACCCAGCCCAGCATTCCCGG + Intronic
1162328511 19:10012428-10012450 CCTGCCCTGCCCTGCCTTGCTGG + Intergenic
1163411686 19:17158851-17158873 CCCACATAGCACGGGCTTGCCGG - Intronic
1163422156 19:17219856-17219878 CCCATCTAGCAGTGCCTTTCAGG + Intergenic
1164708823 19:30339934-30339956 TCCACCCAGCTCACCCTTGCAGG - Intronic
1164720157 19:30426014-30426036 CCGACCCACCACTGCTCTGCTGG - Intronic
1164925800 19:32129104-32129126 CCCACCAAGTTCTGCCTTCCAGG + Intergenic
1166198265 19:41220367-41220389 CACGCCCTGCACTGCCTGGCAGG - Intronic
1166864785 19:45829222-45829244 CCCACCCTACACTGACATGCTGG - Intronic
1167209199 19:48122538-48122560 CACTCCCAGCCCCGCCTTGCTGG + Intronic
1168084500 19:54035460-54035482 CCCACCAAGGACAGCTTTGCAGG + Intergenic
1168137928 19:54364230-54364252 CCCACCCAGCACTGCCCTTGGGG + Intronic
1168160002 19:54503778-54503800 CCCACCCAGCACTGCCTTTGGGG - Intronic
1168250128 19:55137254-55137276 CCCACAGAGCACTGCCGTGTCGG + Intronic
925192293 2:1894251-1894273 CCCACCCCGCCCTGCACTGCTGG - Intronic
925410381 2:3636472-3636494 CCCACCACCCACTGTCTTGCAGG + Intronic
925919711 2:8630654-8630676 CCCACCCGGCTCTGCCCTGGTGG + Intergenic
926691207 2:15735211-15735233 CACACCTTGCACTTCCTTGCAGG - Intronic
927010689 2:18900687-18900709 CCAAACCACCACTGCCTGGCTGG - Intergenic
931317090 2:61143148-61143170 CCCACAAAGCACAGCTTTGCAGG + Intergenic
931754506 2:65360365-65360387 CACACCCAGCAGTGAGTTGCTGG + Intronic
932721633 2:74142961-74142983 CCCACCAAGCTCTGCCTCGAGGG - Intronic
933786516 2:85847192-85847214 CCCAGCCAGCACTGCCTTCCAGG + Intronic
934087531 2:88522650-88522672 ACCTCCCAACACTGCCATGCTGG + Intergenic
934119854 2:88828458-88828480 AGCACCCAGCACAGCCTGGCTGG - Intergenic
934529722 2:95077268-95077290 CCCCCCCAGCTCTGCCCAGCGGG - Intergenic
935146598 2:100399676-100399698 CCCACCCAGCTCTTCCTTTATGG + Intronic
936163328 2:110100996-110101018 AGCACCCAGCACAGCCTGGCTGG - Intronic
938387246 2:130875672-130875694 ACCTCCCAACACTGCCATGCTGG + Intronic
938947448 2:136226045-136226067 CCCCCTCAGCACTCCCTGGCAGG + Intergenic
939839790 2:147173130-147173152 CCTGCCCAGCCCTGCCTTGCTGG + Intergenic
940638531 2:156326101-156326123 CCCCTCCAGAACTGCCTAGCAGG - Intronic
940773611 2:157864146-157864168 GCCACCGTGCCCTGCCTTGCAGG + Intronic
942190571 2:173465082-173465104 CCAGCTCCGCACTGCCTTGCAGG - Intergenic
946071802 2:217040452-217040474 CCCATCCAGCACTGCGGGGCTGG - Intergenic
946229483 2:218282645-218282667 CCAACCCAGCTCTGGCTTCCAGG - Intronic
947874558 2:233459643-233459665 CACACCCGTCCCTGCCTTGCAGG - Intronic
948081307 2:235207431-235207453 CACACCCAGCCCTGCCTTCATGG + Intergenic
948665393 2:239531621-239531643 CCCAGCCAGCACTGAGTTGAAGG - Intergenic
948863530 2:240764180-240764202 CCCCCTCAGCACCTCCTTGCTGG + Intronic
948973415 2:241447433-241447455 GACACCCAGCTCTGCCGTGCAGG - Intronic
949022652 2:241750190-241750212 CTCACCCAGCATCCCCTTGCAGG - Exonic
1169257589 20:4110866-4110888 GCCACCCAGCTCAGCCTTGTGGG - Intergenic
1171217764 20:23364526-23364548 GGCAGCCAGCACTGCCTTGTGGG - Exonic
1172255719 20:33515560-33515582 CCCACCCACCTCAGCCTCGCTGG - Intronic
1172448067 20:35003375-35003397 CCCACCCATCACCCCCTTGAGGG + Intronic
1172695793 20:36822093-36822115 CCCACACAGCCCTGCCATTCTGG + Intronic
1172890347 20:38260055-38260077 CTCGCCCTGCACTGCCTGGCTGG + Intronic
1173538181 20:43831704-43831726 TCCACCCAGGTCTGACTTGCAGG - Intergenic
1175382944 20:58576328-58576350 CCAGCCCAGAACTGCCTGGCAGG - Intergenic
1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG + Intronic
1175936361 20:62515965-62515987 CGCACCCAGGGCTGCCTTGAGGG - Intergenic
1176522903 21:7838214-7838236 GCCAACCAGCATTGCTTTGCAGG + Intergenic
1176546173 21:8201210-8201232 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1176565124 21:8384256-8384278 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1178409826 21:32353872-32353894 CCCACCCTGCACAGACTAGCCGG + Intronic
1178656923 21:34468226-34468248 GCCAACCAGCATTGCTTTGCAGG + Intergenic
1179176327 21:39010702-39010724 CCCTCCCAGCTCTGGCCTGCTGG + Intergenic
1179291466 21:40021528-40021550 TGCACCCATCACTGCCTTTCTGG + Intronic
1180083481 21:45497259-45497281 CCCTCCCAGCACAGCCGTCCAGG + Intronic
1180682629 22:17638904-17638926 CTCACCCAGCTCAGCCTTCCCGG - Intronic
1181011518 22:20043620-20043642 CCCACCCAGCACTGTCTGCGTGG + Intronic
1181464999 22:23106204-23106226 CTCAACCATCACTGACTTGCAGG - Intronic
1182273345 22:29169756-29169778 CAGACCCAGCCCTGCCTTCCTGG - Intergenic
1182419230 22:30240839-30240861 CCAGTCCAGCTCTGCCTTGCCGG - Exonic
1182557279 22:31136046-31136068 CCCACCCCTCTCTGCCTTGCTGG - Intronic
1182748328 22:32622615-32622637 CCCTCCCAGCTCTGACTTTCTGG - Intronic
1183143143 22:35963273-35963295 CCCACCCCGCACTGCAATGTGGG - Intronic
1183201111 22:36386727-36386749 CACCCCCAGCACTAGCTTGCCGG - Intronic
1183678247 22:39311811-39311833 TCCACCCAGCAGTGTCTGGCAGG - Intergenic
1184231351 22:43159926-43159948 CCCTCCCAGCACGTCCTTTCCGG - Intronic
1184512252 22:44940576-44940598 CCCACCCAGCACTGTTTCTCTGG - Intronic
1184644435 22:45888593-45888615 CCCACCAAGCACTTCCATTCTGG + Intergenic
1184790693 22:46698026-46698048 CCCACCCAGACCTGCCGTGTTGG + Intronic
1184834280 22:47011984-47012006 CCCACCCCGCTCTGCCTTGGTGG + Intronic
1184975883 22:48061613-48061635 CCCTCCCAGCTCTGGCTTTCTGG - Intergenic
1185220847 22:49628474-49628496 ACCCCCCATCACTGCCTTCCAGG + Intronic
1203251045 22_KI270733v1_random:117447-117469 CCCCCCCACCACCGCCTTGGTGG + Intergenic
950106769 3:10393523-10393545 CCATCCCAGCTCTGCCTTCCTGG - Intronic
950540531 3:13609660-13609682 CCCACCCCACCCTGCCTTGAAGG - Intronic
950859957 3:16139210-16139232 GCCACTCAGCACAGCCTTGACGG - Intergenic
952454817 3:33463168-33463190 CCCACAAAGCACAGCTTTGCAGG - Intergenic
954325720 3:49862259-49862281 CCCACCCAGCCTTGCCTGACAGG + Intronic
954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG + Exonic
954704697 3:52473228-52473250 CCGACCCAGCCCTGCCAAGCAGG + Intronic
954752264 3:52820253-52820275 ACCACCCAGCACAGCCTTTGAGG + Intronic
954988068 3:54813271-54813293 CCAACCAGGCTCTGCCTTGCTGG - Intronic
955599955 3:60634618-60634640 GCCACACAGCACTGCATTACTGG - Intronic
958458383 3:94362562-94362584 GGTTCCCAGCACTGCCTTGCAGG + Intergenic
958986005 3:100780463-100780485 CTCATCCTGCACTGCCTTACTGG + Intronic
962316660 3:134363640-134363662 GCCCCCCAGCACTGCCCTTCTGG - Intronic
963534201 3:146507665-146507687 CCCACCCAAAAAAGCCTTGCAGG + Intergenic
963817984 3:149855030-149855052 TGCACCCAGCCCAGCCTTGCAGG - Intronic
963962713 3:151327236-151327258 CCTACTCAGCAATGCCTTCCTGG - Exonic
965474636 3:169140149-169140171 CCTACCCTGCTCTGCCTTTCAGG + Intronic
968423452 4:504703-504725 CCCAGCCAGCACTGGCATCCTGG - Intronic
968467970 4:762453-762475 AACTCCCAGCACTGCCCTGCTGG - Intronic
969397099 4:6929129-6929151 ACCACCCAGCACTCCCTCTCAGG - Intronic
969598629 4:8162818-8162840 CTCACCCAGCTCAGCCATGCAGG - Intergenic
970428333 4:15965384-15965406 CCCACCCACCACAGTGTTGCAGG + Intronic
973145731 4:46823165-46823187 CCCACCCAGCAGAACCTTGGAGG - Intronic
978062111 4:104351473-104351495 CCCTCCCAAGACTGCCTTCCTGG + Intergenic
980576387 4:134687970-134687992 CCCCCCCAACGCTGCTTTGCTGG - Intergenic
980850380 4:138374130-138374152 CCCACTGGGCACTGCCTAGCAGG - Intergenic
981616984 4:146652675-146652697 CCCCCCCAGCACACTCTTGCAGG + Intergenic
985482864 5:128225-128247 CCCACCAAGGACAGCTTTGCAGG + Intergenic
985519876 5:369121-369143 CCCATCCAGCACCCACTTGCTGG + Intronic
985767504 5:1787636-1787658 CCCACACAGCCCTGCCCTCCCGG - Intergenic
985928516 5:3036108-3036130 CCCTCCCACCTCCGCCTTGCAGG - Intergenic
986630475 5:9767539-9767561 CCCAGCAAGCACTGCCTCACTGG + Intergenic
988507216 5:31833910-31833932 ACCACCCTGCACTGCCCAGCAGG - Intronic
989133769 5:38133283-38133305 CCTGCACAGCACTGCCTTGTCGG + Intergenic
989213543 5:38880746-38880768 CCAACCCACCAGTCCCTTGCAGG - Intronic
990168128 5:53017827-53017849 TCCCCCCAACACTGCTTTGCTGG - Intronic
991484469 5:67120147-67120169 CCCACCCAACACTGGCCTCCAGG - Intronic
992750359 5:79855724-79855746 CACACTCAGCTCTGACTTGCTGG + Intergenic
992952061 5:81868977-81868999 CTCACCCAGCACTCACTTGGTGG + Intergenic
993744241 5:91576473-91576495 ACCACCCAGCAATCCCTTACTGG + Intergenic
994641208 5:102411809-102411831 CCCACAAAGGACTGCTTTGCAGG - Intronic
995064329 5:107843061-107843083 CCCACTCAGCACTGCCAGGTTGG - Intergenic
997472808 5:134126111-134126133 CCCACCCACCTCTGCCTGCCTGG - Intronic
998041494 5:138953513-138953535 CCCACCCTGTACTTCCTTTCTGG - Intronic
998515726 5:142752207-142752229 CCCACCCAGAACAGCATTCCAGG - Intergenic
1000287084 5:159836186-159836208 ACCACTGAGCACTGCCTTTCTGG - Intergenic
1001696732 5:173675762-173675784 CCTACCCAGGACTGCCTGGCAGG + Intergenic
1002309638 5:178306687-178306709 AGCACCCAGTACTGCCTTTCCGG - Intronic
1002467098 5:179413017-179413039 CTCCCCCAGCACGGCCATGCTGG + Intergenic
1002942800 6:1733059-1733081 CAGACCCAGCACTTCCTTACAGG + Intronic
1006650229 6:35545208-35545230 GCCACCCTGCCCTGCCCTGCGGG - Intergenic
1006758827 6:36441555-36441577 CCCTCCCAGCACTTCCGGGCTGG - Intronic
1007311412 6:40949107-40949129 CCCACCAAGGACGGCTTTGCAGG - Intergenic
1007397115 6:41584290-41584312 CCCAGCCAGGCCTACCTTGCAGG + Intronic
1010002135 6:70957995-70958017 CCCACCCAACACAGCCGGGCCGG + Intergenic
1013415051 6:109917540-109917562 GCCACCCACCCCTGCCTTGGTGG + Intergenic
1018545315 6:164929267-164929289 TCGACACAGCACTGCCTGGCTGG - Intergenic
1019485132 7:1285835-1285857 CCCCCCCAGCCCTGCCTTCCTGG + Intergenic
1019550179 7:1598297-1598319 CCCACCCACGATTGCCTTCCAGG + Intergenic
1019586736 7:1809186-1809208 CCCACTCAGCCCTGCCATACTGG + Intergenic
1019685490 7:2379722-2379744 CTCACCCAGCACTGCCTGAAAGG - Intronic
1019827801 7:3299152-3299174 CCCAACCACCTCTGCTTTGCTGG - Intergenic
1020111573 7:5450923-5450945 CCCACCCATCCCAGCCTTGCTGG - Intronic
1020252067 7:6477214-6477236 TCCACGCAGGACAGCCTTGCTGG + Intronic
1021078385 7:16333538-16333560 CCCACCAAGCACTGCTTTTGTGG - Intronic
1021581242 7:22156328-22156350 CCCACACAGCCTGGCCTTGCAGG + Intronic
1021605458 7:22405196-22405218 GTCACCCAGCCCTGCCTAGCTGG - Intergenic
1023417635 7:39948163-39948185 CCCACCCAGGCCTGCCCTCCTGG + Intergenic
1023987100 7:45103106-45103128 ACCCCCCAGCGCTGCCTGGCAGG + Intronic
1024000880 7:45188832-45188854 CCCACGCAGCTCTGCGCTGCAGG + Intergenic
1026143112 7:67722961-67722983 CCCACAAAGGACAGCCTTGCAGG - Intergenic
1026928742 7:74211130-74211152 CCCACCCCGCCCAGCCCTGCCGG + Intronic
1029115405 7:98233929-98233951 CAGACCCATCACTCCCTTGCAGG + Intronic
1029121416 7:98270656-98270678 CCCACCCTCCACTGCCTCCCTGG - Intronic
1029224463 7:99014843-99014865 TCCACCCGGCACAGCATTGCTGG + Intergenic
1029580491 7:101433836-101433858 CCAACCCAGGAGTGCCTTGAAGG + Intronic
1029709100 7:102289854-102289876 CCCACCCCACCCTGCCTTTCTGG - Intronic
1031020708 7:116624874-116624896 CCTCCCCAACACTGCCTTTCAGG - Intergenic
1032463102 7:132126295-132126317 CCCACCCAAAGCTGCCTTCCTGG - Exonic
1033456986 7:141511753-141511775 CCGACCCAGGAATGCCTGGCGGG - Intergenic
1034292680 7:149945326-149945348 CTCACCCAGACCTCCCTTGCTGG - Intergenic
1034670141 7:152851627-152851649 CCCAGCCAGCACTGCCCTCCAGG - Intronic
1034813384 7:154151546-154151568 CTCACCCAGACCTCCCTTGCTGG + Intronic
1035439213 7:158881982-158882004 TCCACCCAGAAATGCCTTTCTGG + Intronic
1035584782 8:763646-763668 CTCAGCCAGCACTGCCTCTCTGG - Intergenic
1039441782 8:37600084-37600106 CCCACCAAGCAAGGCCTTTCTGG + Intergenic
1039754651 8:40510755-40510777 CACACCCAGCCCTGGCTTGTAGG + Intergenic
1039821490 8:41139134-41139156 CCCACCCTGCACTGACCTCCTGG + Intergenic
1040007038 8:42629486-42629508 CCCCTCCAGCAGTGCCTAGCAGG - Intergenic
1040286009 8:46100751-46100773 CCCACCCAGGACAGCCCTGGGGG + Intergenic
1040304895 8:46206907-46206929 CCCACCCAGGACAGCCTTAGTGG - Intergenic
1040315044 8:46256540-46256562 CCCACCCAGGACAGCCCTGGGGG - Intergenic
1040331009 8:46385754-46385776 CCCACCCAGGACAGCCTTTGGGG - Intergenic
1040342118 8:46446347-46446369 CCCACCCCGGACAGCCTTGGGGG + Intergenic
1040456047 8:47599017-47599039 CCCAACCAGCACTCCCCTGAGGG + Exonic
1045604804 8:103760479-103760501 CTCACCCAGCACTGCCATGGTGG - Intronic
1048907021 8:139098272-139098294 TCCAGTCAGCGCTGCCTTGCTGG - Intergenic
1049036527 8:140080680-140080702 ACCTCCCAACACTGCCATGCTGG + Intronic
1049172524 8:141170642-141170664 CCCACCCCGCCCTGCCTGGCTGG - Intronic
1049988372 9:972004-972026 CCCTCCCAGCCCGGCCTCGCGGG - Intergenic
1049990439 9:985803-985825 CTCACCCAGCACTACTTAGCAGG + Intronic
1055742638 9:79406973-79406995 TCCAGCAAGCACTCCCTTGCTGG + Intergenic
1057606584 9:96502188-96502210 CCCACCCGACAGTGCCTGGCGGG + Exonic
1059405824 9:114098070-114098092 CCCACCCAGCCCCGCCCCGCGGG + Intronic
1060545476 9:124456712-124456734 CGCATCCAGCACCGCCATGCTGG + Exonic
1060918098 9:127403191-127403213 CCCACCCAGCACTGTGAAGCAGG - Intronic
1061181103 9:129025768-129025790 CCCACCCCGCCCTCCCTTACAGG + Intronic
1061403594 9:130381867-130381889 CACCCCCAGCACTGCCATGAAGG + Intronic
1062144668 9:134982430-134982452 CCCACCCAGCCCTGATGTGCAGG - Intergenic
1062152758 9:135030364-135030386 CTCCCCCAGGCCTGCCTTGCTGG - Intergenic
1062315758 9:135966376-135966398 CCCACTCAGCTCTGCCATGCAGG - Intergenic
1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG + Intronic
1203467450 Un_GL000220v1:100714-100736 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1186518405 X:10184558-10184580 GCTTCCCAGCACTGCATTGCAGG - Intronic
1186799585 X:13079442-13079464 GCCAGCAAGCACTGCCTGGCAGG + Intergenic
1189347852 X:40255865-40255887 CCCACCCAGCAGTGGTTGGCTGG - Intergenic
1190598295 X:52067218-52067240 CCGGCCCAGCACAGCCTTCCTGG - Exonic
1190610529 X:52186855-52186877 CCGGCCCAGCACAGCCTTCCTGG + Exonic
1191843323 X:65528451-65528473 ACCTCTCAGCACTGCCCTGCAGG + Intronic
1193807957 X:86016374-86016396 CCCACCCATCACAGGCCTGCAGG + Intronic
1194351918 X:92831279-92831301 CCCACAAAGGACTGCTTTGCAGG - Intergenic
1198299503 X:135321269-135321291 ACCACCCAGCACTGCTGTACTGG + Intronic
1198512146 X:137362903-137362925 CCCATCCAGCCATGCCATGCGGG + Intergenic
1200660227 Y:5947971-5947993 CCCACAAAGGACTGCTTTGCAGG - Intergenic
1201077095 Y:10196629-10196651 CAAACCCAGCTCTGCCTTGTGGG + Intergenic