ID: 1157297528

View in Genome Browser
Species Human (GRCh38)
Location 18:46456964-46456986
Sequence CCTTCAGAGGACAGGATTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157297528_1157297533 6 Left 1157297528 18:46456964-46456986 CCCTCAATCCTGTCCTCTGAAGG 0: 1
1: 0
2: 2
3: 14
4: 227
Right 1157297533 18:46456993-46457015 TATATACCTCTCGACCACGTAGG 0: 1
1: 0
2: 0
3: 0
4: 23
1157297528_1157297536 18 Left 1157297528 18:46456964-46456986 CCCTCAATCCTGTCCTCTGAAGG 0: 1
1: 0
2: 2
3: 14
4: 227
Right 1157297536 18:46457005-46457027 GACCACGTAGGAACCATGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1157297528_1157297535 17 Left 1157297528 18:46456964-46456986 CCCTCAATCCTGTCCTCTGAAGG 0: 1
1: 0
2: 2
3: 14
4: 227
Right 1157297535 18:46457004-46457026 CGACCACGTAGGAACCATGTAGG 0: 1
1: 0
2: 0
3: 1
4: 28
1157297528_1157297537 19 Left 1157297528 18:46456964-46456986 CCCTCAATCCTGTCCTCTGAAGG 0: 1
1: 0
2: 2
3: 14
4: 227
Right 1157297537 18:46457006-46457028 ACCACGTAGGAACCATGTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157297528 Original CRISPR CCTTCAGAGGACAGGATTGA GGG (reversed) Exonic
900138964 1:1131106-1131128 CCTTCACAGGACAGCAGAGATGG - Intergenic
900233963 1:1577756-1577778 CCTGTAGATGACATGATTGATGG + Intergenic
901372129 1:8807989-8808011 CCTTCAGAGGCCAGGCGTGGTGG + Intronic
901405198 1:9040458-9040480 CCTTCAGAGGACAGTCTTGCAGG + Intronic
901754596 1:11433940-11433962 CCTTCAGAGGAGATGATCAATGG + Intergenic
906844330 1:49174850-49174872 ACTTCAGAGGTCAGAATAGATGG - Intronic
912306402 1:108572020-108572042 CAGTCAGAGTGCAGGATTGAGGG - Intronic
913538661 1:119798016-119798038 CATTCTGGGGACAGGATTCAGGG + Intronic
916957375 1:169853114-169853136 CATTTAGAGAACAGGATTGTGGG + Exonic
918491376 1:185084917-185084939 GCTCCAGAGTACAGGAATGAGGG + Intronic
919008215 1:191927357-191927379 CCTTGAGAGGACTGCATAGAAGG + Intergenic
919342425 1:196329421-196329443 CTTTCAGAGAACAGGATTGATGG - Intronic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
921340514 1:214129440-214129462 CCTGCAGAGCACAGGACTGAGGG + Intergenic
922001003 1:221478180-221478202 CCTTCAGAGAGCAGGAGCGATGG - Intergenic
922963093 1:229664805-229664827 CTTTCAGAGGGCAGTTTTGATGG - Intergenic
923010648 1:230084984-230085006 CCTTTAGGGCACAGGATTTAAGG - Intronic
923490739 1:234481842-234481864 ACTGCAGAGCACAGCATTGAAGG + Intergenic
923984637 1:239367527-239367549 TCCTTAGAGGACAGGATTGCTGG - Intergenic
1063131868 10:3185372-3185394 ACTTCAGAGGGCCGGCTTGACGG + Intergenic
1063672366 10:8109580-8109602 CATTCAGAGGACAGGAACGATGG - Intergenic
1064947785 10:20811312-20811334 ACATCAGAGGTCAGGAATGATGG - Intronic
1067274492 10:44821796-44821818 CCTTCAGATGTCAGGAGTGCAGG + Intergenic
1070453237 10:76582754-76582776 CCAGCAGAGAACAGGACTGACGG - Intergenic
1071728460 10:88223167-88223189 CCTGAAGAGAACAGGATAGAAGG - Intergenic
1072027727 10:91478209-91478231 CGTTCAGAAGACAGTATTAAAGG + Exonic
1072095514 10:92175114-92175136 TTTTCAGAGGACAAAATTGAGGG - Intronic
1072235214 10:93447810-93447832 CCCTCAGATGACAGCAGTGATGG - Intronic
1072279031 10:93849259-93849281 CCTTCAGAAGACAGCACTGTCGG + Intergenic
1072811970 10:98468912-98468934 CCCTCAGAGGGTAGGATGGAGGG - Intronic
1075686421 10:124367947-124367969 GCTTCCGAGGACAGGAATCAAGG + Intergenic
1076695510 10:132245564-132245586 CCTACAGGGGACAGGACGGAGGG - Intronic
1081807393 11:45897959-45897981 CCCCCAGAGGACAGGATTTGGGG - Intronic
1088586426 11:111363832-111363854 CCCTCAGACCACAGGATTAATGG - Intronic
1092850844 12:12625008-12625030 ACTTCAGAGGAATGGCTTGACGG - Intronic
1093017703 12:14171339-14171361 CCTTCAGAGGAAAGACTTGCTGG + Intergenic
1094133263 12:27097674-27097696 CCTTCAGAAAACAGAATTTAGGG + Intergenic
1094183084 12:27612888-27612910 CCTTCAGAAAACAGAATTTAGGG + Intronic
1095877371 12:47096512-47096534 GCTTAAGAGGACAGGATACAGGG - Intronic
1099280662 12:80641619-80641641 CCTTCAGAGGACCTGCTTGATGG + Intronic
1100710665 12:97252767-97252789 CCCTCAGATGACAGCAGTGAAGG - Intergenic
1101238887 12:102818270-102818292 CCTACTGAGGAGAGGATAGAGGG - Intergenic
1101769209 12:107733021-107733043 CCTTAAGTTGACAGGATTGATGG - Exonic
1103209958 12:119158491-119158513 CCATCAGAAGACAGGAGTGAGGG + Exonic
1105237338 13:18569578-18569600 TCTTAAGAGAACAGGATTGCTGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106171611 13:27293433-27293455 CCTTCCGATGAAAGGATGGAGGG - Intergenic
1106798955 13:33236217-33236239 CTTTCAGAAGACAGAATTTATGG + Intronic
1108101007 13:46955238-46955260 CCTGCAGTGGACAGTATTTAGGG + Intergenic
1113807757 13:113119788-113119810 CCTTCAGAGGACAGCACACATGG - Exonic
1114569482 14:23656582-23656604 TCTTCACAGGGCAGGAGTGAAGG + Intergenic
1114648425 14:24268453-24268475 CCTTGAGAGGAAAAGAGTGATGG + Intronic
1116728988 14:48598290-48598312 CCTTAATAGGATAGGATTGGTGG + Intergenic
1117456429 14:55901765-55901787 AGATCAGAGGACAGGATGGAAGG + Intergenic
1118445159 14:65843841-65843863 CCCTCAGAGGACAGAGCTGAGGG - Intergenic
1119216894 14:72876197-72876219 CCTGTAGCTGACAGGATTGATGG + Intronic
1122562522 14:102626487-102626509 ACTTCTGGGGACAGGTTTGAGGG + Intronic
1122715735 14:103695967-103695989 CCTTCAGAGGAGAGAAGTGGTGG + Intergenic
1125509449 15:40284916-40284938 CCTTCAGGGGACACTATTGAGGG + Intronic
1127801105 15:62478155-62478177 TTTACAGAGGACAGGACTGAAGG + Intronic
1127812381 15:62575710-62575732 CCTGCAGAGGTCAGGCCTGAAGG + Intronic
1128738658 15:70068193-70068215 TCTTCCGAGGGTAGGATTGAAGG - Intronic
1128985089 15:72214454-72214476 CTTCCACAGGACAGCATTGATGG - Intronic
1129703330 15:77780570-77780592 TCGTCAGAGGACAGGAGTGCAGG + Intronic
1131450991 15:92539823-92539845 CATTCAGAGGAAAGGCTTGAAGG + Intergenic
1132827765 16:1913630-1913652 CCCTCAGAGGGCAGGAGTCAGGG - Intronic
1132967816 16:2669052-2669074 CCCTCAGAGGAGAGGAAAGAGGG + Intergenic
1133349658 16:5093146-5093168 CCTTCAGCGGGCAGGACAGAGGG + Intronic
1134278580 16:12798636-12798658 CCTTCAGAGAACTGGACTAATGG - Intronic
1136396333 16:29994514-29994536 CGTTCAGAGGACAGCAAAGAAGG - Exonic
1136552618 16:30989681-30989703 CCTGCAGAGGACAAGATGGGTGG - Exonic
1137466486 16:48714504-48714526 CCTTGAGAAGAAAGGATGGAGGG - Intergenic
1137593188 16:49706433-49706455 CCTTTAGAGCACAGGACTGGAGG - Intronic
1141640308 16:85337239-85337261 CCTTAGGAGGACAGGCCTGAGGG + Intergenic
1142184256 16:88686890-88686912 AACTCACAGGACAGGATTGATGG + Intergenic
1142341437 16:89525524-89525546 CCAGCAGAGGACAGGGATGAGGG - Intronic
1146142071 17:30377071-30377093 CATTCACAGGACCGGAGTGACGG + Intergenic
1147234081 17:39044379-39044401 CCTACACAGGTCCGGATTGATGG + Intergenic
1148537754 17:48455075-48455097 ACTTCAGAGGAATGGCTTGATGG + Intergenic
1151326119 17:73380678-73380700 CCAACAGAGGGCAGGCTTGAAGG + Intronic
1153439908 18:5104719-5104741 CCTTCAGAGGACAGAGGAGAAGG + Intergenic
1153694772 18:7629235-7629257 CCTTCTGTGGACAGGTTAGATGG - Intronic
1153799250 18:8655174-8655196 CCTGCTGAGGACAGGAGTGGGGG + Intergenic
1157297528 18:46456964-46456986 CCTTCAGAGGACAGGATTGAGGG - Exonic
1157954409 18:52081198-52081220 CCTTGGGAGGGAAGGATTGATGG - Intergenic
1158315413 18:56207079-56207101 CTTTCAGAGGACAAGAGTGGGGG + Intergenic
1158638249 18:59180031-59180053 CCTCCAGAGGAAAGGCTGGAAGG - Intergenic
1158967557 18:62636082-62636104 CCATCAGAGGGCAGGAGTCAGGG + Intergenic
1160243748 18:77141109-77141131 CCCTCAGAGTACAGGAGAGAGGG + Intergenic
1160288196 18:77566700-77566722 CCTTCAGAGCCCAGGACTGCTGG + Intergenic
1160322881 18:77913002-77913024 TCTTCAGTGGACAGCAGTGATGG + Intergenic
1160340107 18:78082458-78082480 CCTTCAGAGGAAAGGAGGGTGGG + Intergenic
1162389584 19:10381129-10381151 GCTTCAGAGGACAGGGCTGCAGG - Intergenic
1163750769 19:19076070-19076092 CCTTCTGAGGACAGCATTCTGGG - Intronic
1164960234 19:32421882-32421904 ATTTAAGAGGACAGGAATGAAGG + Intronic
1165177273 19:33939417-33939439 CCTTTGGAGGACTGGTTTGAAGG - Intergenic
1165261749 19:34624832-34624854 GATTCAGGGGACAGGCTTGATGG - Intronic
1166274730 19:41745136-41745158 CCCTCTGAAGAGAGGATTGATGG - Intronic
1166602402 19:44108996-44109018 ACTTCAGAGCACAGGATGGGGGG - Exonic
926066803 2:9847276-9847298 CTTTCAGACGACAGGCTTAAAGG + Intronic
926280231 2:11440229-11440251 CCTTCAGAGGACAGGAGGCGAGG - Intergenic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
928774302 2:34739790-34739812 GCTTCAGAAAACAGCATTGAGGG - Intergenic
932365536 2:71150552-71150574 GCTGCAGAGGACAGGTATGATGG + Intergenic
932655367 2:73606779-73606801 CCTTAATAGGACACAATTGAAGG - Intronic
933250645 2:80025052-80025074 ACTTCAGAGGAACGGCTTGATGG - Intronic
933360737 2:81280602-81280624 TCTTCAGAAGACAGTTTTGAAGG + Intergenic
933808652 2:86018241-86018263 CCTTCAGAGGCCACGATGGAAGG + Intergenic
935090440 2:99890671-99890693 CCTTCAAAGGGCAGGACTGTGGG + Intronic
936604144 2:113931633-113931655 CTTTCATAGGACAGAAATGAAGG + Intronic
937214542 2:120303306-120303328 CCTACAGAGGAGAGGTTTGGAGG - Intergenic
937846874 2:126588326-126588348 CACTCAGAGGAGTGGATTGAGGG - Intergenic
938512439 2:131964925-131964947 TCTTAAGAGAACAGGATTGCTGG + Intergenic
939808275 2:146802181-146802203 CCTTGAGAAGACAGGTTTGTGGG - Intergenic
941361405 2:164556516-164556538 GAGTCAGAGGACAGGATTGTAGG - Intronic
943768583 2:191690537-191690559 CCTCCAGAGGGCAGAATTGTTGG + Intronic
944415989 2:199480263-199480285 CCTTCAGAGTCCAGGATGAAGGG + Intergenic
946043449 2:216802328-216802350 CCTTCAGAACAAAGGATTGCTGG - Intergenic
946683004 2:222237252-222237274 ACTTCAGAGGACATGCTTGCTGG + Intronic
947390702 2:229636412-229636434 CCTCGAGAAGACAGGATAGATGG + Intronic
1169385018 20:5141376-5141398 GCTTTAGAGGACAGGGTTCAGGG + Intronic
1169461752 20:5801600-5801622 CCTTCAAAGGCCAGGACAGATGG + Intronic
1170072177 20:12381070-12381092 CCTGTAGAGGTCAGGCTTGAAGG - Intergenic
1171361675 20:24590464-24590486 CCTTCAGAGAACAGGGCGGAGGG + Intronic
1171485088 20:25480542-25480564 TCTTCAGGGAACAGGATTTAGGG - Intronic
1173135850 20:40438175-40438197 CCTGCAGAGGACAGCTTGGAAGG - Intergenic
1173264374 20:41465875-41465897 CCTTTAGAGAACAGGATGGAAGG - Intronic
1173833456 20:46108851-46108873 CCTTCAGAGGGCAGGCCAGAAGG - Intergenic
1173875329 20:46366943-46366965 CCTGCAGAGGACAGGTGTGTTGG - Exonic
1174984747 20:55438235-55438257 CCTTCAGTTGGCAGGATTGCTGG + Intergenic
1176781325 21:13197861-13197883 TCTTAAGAGAACAGGATTGCTGG - Intergenic
1177363644 21:20105034-20105056 ACTTCAGAGGAATGGCTTGATGG + Intergenic
1177825731 21:26080920-26080942 CCTGCAGCGGACAGTATTTATGG + Intronic
1177844602 21:26273967-26273989 CCTTTAAGGGACAGGATTGCTGG - Intergenic
1177979018 21:27887007-27887029 TCTTAAGAGAACAGGATTGCTGG - Intergenic
1178282257 21:31293627-31293649 CCTTCAGAGCACAGGACAGGTGG - Intronic
1178359203 21:31933842-31933864 TCTTCAGACGGCAGGACTGAAGG + Intronic
1180949555 22:19714953-19714975 GCTTCAGAGGAGAGGAGTGGGGG + Intronic
1181159186 22:20947159-20947181 GCTGCAGAGCACAGGATTCAAGG - Intronic
1183339765 22:37273780-37273802 CCTTCAGATGACAGGATTGCAGG + Intergenic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1184153665 22:42653019-42653041 CAGCCAGAGGACAGGATTGCTGG - Intergenic
1184989569 22:48157725-48157747 CCCTCAGAGTGCAAGATTGATGG - Intergenic
949454663 3:4225952-4225974 CCATCAGAGGGCAGGATGGTGGG + Intronic
950768754 3:15293701-15293723 CCTTGCGAGGACAGGAGTGAAGG - Intronic
951129101 3:19020288-19020310 CATTCAGAGGTCAGGATTCTGGG + Intergenic
951234939 3:20223655-20223677 CATTCACAGCACAGGATTGTGGG - Intergenic
951546221 3:23828940-23828962 CTTTCAGTGGACAGGGTGGATGG + Intronic
951688954 3:25375366-25375388 CCTTCAGAGTTAGGGATTGATGG - Intronic
952191741 3:31029933-31029955 TCATCAGAGGACAGGAGAGAGGG - Intergenic
955649869 3:61182649-61182671 CATTAATAGGACAGGATGGAGGG - Intronic
957053968 3:75430494-75430516 CCTTCAGCGGGCAGGACAGAGGG + Intergenic
958804039 3:98787917-98787939 GCTTCAGAGCACAGGATAAAAGG + Intronic
958994668 3:100890346-100890368 CCTTTAGAGGAAGGGAATGAGGG - Intronic
961887639 3:130106871-130106893 CCTTCAGCGGGCAGGACAGAGGG + Intronic
962662442 3:137617003-137617025 ACTTCAGAAGACAGGGTAGAGGG + Intergenic
962914319 3:139885379-139885401 CCTTGATAGGGCTGGATTGAGGG + Intergenic
963643255 3:147883118-147883140 GCTGCAGAGGACAGGCTTGCTGG - Intergenic
966498577 3:180610135-180610157 AATTCAGAGGACAAGATTTATGG + Exonic
966865614 3:184257703-184257725 CCTTCAGAGGACACGGTCCAGGG - Exonic
967641623 3:191872011-191872033 CCATGAGAAGACAGCATTGATGG + Intergenic
967826648 3:193882544-193882566 TTTTAAGAGGACAGGAATGAGGG - Intergenic
969060108 4:4427437-4427459 ACTTAAGAGGACAGTATTTAAGG + Intronic
973547035 4:51992257-51992279 TCATGAGAGGACAGGAATGAGGG + Intergenic
974155302 4:58063680-58063702 ACTTCGAAGGACAAGATTGATGG - Intergenic
976436432 4:85023641-85023663 GCTTCAGTGGACATCATTGATGG - Intergenic
979700344 4:123659478-123659500 AGTTCAGAGGACAGAATTGTGGG + Intergenic
980070208 4:128235615-128235637 GCATCAGAGGACAGGGTAGAAGG - Intergenic
980104936 4:128578644-128578666 CCTTCAGAAGGCAGTGTTGAGGG - Intergenic
980395639 4:132211220-132211242 CCTTCAGAGGACAGGTTCCAAGG + Intergenic
981831578 4:149007819-149007841 GCTGCAGAGGACAGATTTGAAGG + Intergenic
982236140 4:153252793-153252815 CCTTCATAGGCCAGGAGTGGTGG - Intronic
985640910 5:1063136-1063158 CCTGGAGAGGACGGGGTTGATGG - Intronic
988942566 5:36160926-36160948 CCTTCAGGGGACAAAATTAAAGG - Intronic
991165657 5:63563556-63563578 GATTCAGAGGACAGGCTTGCTGG + Intergenic
992692394 5:79253908-79253930 CTTTCAGGGGACAGGATGGGTGG - Intronic
994105848 5:95947651-95947673 AATTCAGAGGACTGGATTTAAGG - Intronic
995239119 5:109865808-109865830 CCTTTCAAGGACAGGCTTGATGG - Intronic
998500523 5:142628560-142628582 CCTTGAGAGGCCATGTTTGACGG - Intronic
999709339 5:154302504-154302526 CCTCCAGAGCACAGGGCTGATGG + Intronic
999973381 5:156887262-156887284 GCTTCAGAGGAGAGAACTGAAGG - Intergenic
1000114672 5:158142649-158142671 CCTTCAGGGGACAAGATCCATGG - Intergenic
1001670665 5:173470688-173470710 CCACCACAGGACAGGATTGTGGG - Intergenic
1001969584 5:175943881-175943903 ACTTCAGAGGAATGGCTTGATGG - Intronic
1002247851 5:177899872-177899894 ACTTCAGAGGAATGGCTTGATGG + Intergenic
1002912431 6:1500187-1500209 CCTTCAGAGGACGATATGGAGGG + Intergenic
1003347090 6:5280027-5280049 CCTTCAAAAGACAGGACTAAGGG - Intronic
1003570802 6:7255155-7255177 CCTGAGGAGGACAGGAGTGAGGG + Intergenic
1007331647 6:41115288-41115310 TCCTCAAAGGACAGGATTAAGGG - Intergenic
1008301315 6:49843982-49844004 ATTTCAGAGCAAAGGATTGAAGG + Intronic
1008489835 6:52074883-52074905 CCTTCTGGGGAAAGGATTGGTGG - Intronic
1009979810 6:70714849-70714871 GCTTTAAAGGACAGGATTGCTGG + Intronic
1011422626 6:87189794-87189816 CCTTCCGAGTACAGTATGGAAGG - Intronic
1011656562 6:89557213-89557235 GCTTCAGAGAACGTGATTGAGGG + Intronic
1011797018 6:90967557-90967579 CCTTCAGATGACAGTATTCCTGG - Intergenic
1012016934 6:93864622-93864644 TCTCCAGAGGAGAGGGTTGAAGG - Intergenic
1015604441 6:134940754-134940776 CTTTCATAGCACAGGCTTGAGGG - Intronic
1018957525 6:168420101-168420123 CCTTCAGGGGCCAGGGTAGAGGG - Intergenic
1019412738 7:913645-913667 CCTTCAGAGGCCAGGTGTGGTGG + Intronic
1020762980 7:12290559-12290581 TCTTCAGAGGACAGGCTTGCTGG + Intergenic
1022089408 7:27097820-27097842 TCTTGAGAGGACAGGTTTGGGGG - Intergenic
1023084992 7:36561508-36561530 CCTCCAGAGGACAGAAGAGAAGG + Intronic
1023485812 7:40685338-40685360 ACATCAGAAGACAGGATAGAGGG - Intronic
1024321009 7:48069638-48069660 CCTACAGAGGTCAGGCTTGGTGG + Intergenic
1027193627 7:76012962-76012984 CATTCAGAGGGCAGGCTGGATGG - Intronic
1030213735 7:107022011-107022033 CCTTAGGGGGACAAGATTGACGG - Intergenic
1030484164 7:110145172-110145194 TCTTCAAAGGAAATGATTGAAGG - Intergenic
1032283796 7:130526511-130526533 CCTACAGAAGACAGGGTGGAGGG + Intronic
1034075357 7:148226300-148226322 CCTACATAGGATAGGATTGTTGG + Intronic
1035053359 7:156017475-156017497 GCTTCAGAGGACAGGAGTATGGG - Intergenic
1036166558 8:6439700-6439722 CCTTCAAAAGACATGATTCACGG - Intronic
1036591581 8:10173488-10173510 CCTTCAGGGTTCAGGATTCACGG - Intronic
1037138346 8:15490521-15490543 CCTGCAGAGGCCAGCACTGAAGG + Intronic
1037424454 8:18740459-18740481 CCCTTAGAGAACAGGACTGAAGG - Intronic
1042372223 8:68005111-68005133 CCTGGGGAGGACAGGGTTGAAGG - Intronic
1042738388 8:72014719-72014741 CCTTCAAAGGAGAAGATTTAAGG - Intronic
1044809494 8:96043634-96043656 ACTGCAGAGGAAAGGAATGAGGG + Intergenic
1045343295 8:101272956-101272978 ACTTCAGAGGAAAGGAATCAGGG - Intergenic
1046060445 8:109133214-109133236 CATTCAGATGACATGAGTGAGGG + Intergenic
1046519294 8:115303517-115303539 CCTACAGAGGAAAGTATTAAGGG + Intergenic
1047508470 8:125497978-125498000 CCTTCAGAGGACACGAAGGCAGG - Intergenic
1048687335 8:136919024-136919046 GCTGCAGAGGACAGGCTTGCTGG - Intergenic
1049776439 8:144408010-144408032 CCTTCAGAGGACAGGAGCCCTGG + Intronic
1051100989 9:13521493-13521515 TCTTCAGAGTACAGGAAAGAGGG + Intergenic
1056143123 9:83704074-83704096 CCTCCAGAGGATAATATTGAAGG - Intronic
1056967797 9:91179116-91179138 CCTTCAGAGGAGAGGGCTGTGGG + Intergenic
1057806739 9:98224997-98225019 ACTTCAGAGGACATGAAAGAGGG - Intronic
1059340076 9:113592773-113592795 CCTTCAGAGGCCAGGCATGGTGG - Intronic
1059407884 9:114113172-114113194 CCTTCAGAGGACAGAATCCCAGG + Intergenic
1062595728 9:137298341-137298363 CTTTCAGAAGACAGAATTTAAGG + Intergenic
1203653483 Un_KI270752v1:1188-1210 CCTCCAGAGGGCTGGATTAAAGG - Intergenic
1185611791 X:1397517-1397539 CCTTCAGAGGGCAGTCTTGGGGG - Intergenic
1185749331 X:2598137-2598159 CCTTGAAAGGAAAGGATGGATGG + Intergenic
1188162863 X:26823548-26823570 CCTTCAGATGAGAGAAATGAAGG - Intergenic
1188192281 X:27187004-27187026 CCTTCAGAAGATGGGGTTGATGG - Intergenic
1189204574 X:39226743-39226765 TCTTCAGAAGACAGGAAGGAGGG + Intergenic
1190286006 X:48961902-48961924 CCAGCAGAGGACAGGGTTGCGGG + Exonic
1193131889 X:77929018-77929040 ACTTTGGAGGCCAGGATTGAAGG + Intronic
1195546462 X:106117430-106117452 CCATCAAGGGACAGGATGGATGG - Intergenic
1195705217 X:107733567-107733589 GCTTGAGGGGACAGGATGGATGG - Intronic
1197369365 X:125607355-125607377 CCTTTAGATGACAGGAGTGTAGG - Intergenic
1198625537 X:138568797-138568819 CCTGCAGAGGACACCATTGCAGG + Intergenic
1199759832 X:150897016-150897038 CTTTCAGAAGACAGCTTTGAAGG + Intronic
1200313398 X:155103929-155103951 CATACAGTGGACAGGATTAATGG - Intronic