ID: 1157298857

View in Genome Browser
Species Human (GRCh38)
Location 18:46465374-46465396
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157298857_1157298863 5 Left 1157298857 18:46465374-46465396 CCCAGACCTTATCAATATCTACC No data
Right 1157298863 18:46465402-46465424 CCTCTGCCCACTTCCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157298857 Original CRISPR GGTAGATATTGATAAGGTCT GGG (reversed) Intergenic
No off target data available for this crispr