ID: 1157298858

View in Genome Browser
Species Human (GRCh38)
Location 18:46465375-46465397
Sequence GGGTAGATATTGATAAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157298858_1157298863 4 Left 1157298858 18:46465375-46465397 CCAGACCTTATCAATATCTACCC No data
Right 1157298863 18:46465402-46465424 CCTCTGCCCACTTCCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157298858 Original CRISPR GGGTAGATATTGATAAGGTC TGG (reversed) Intergenic