ID: 1157300473

View in Genome Browser
Species Human (GRCh38)
Location 18:46475233-46475255
Sequence CTGGGTCACCAAAAGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157300467_1157300473 -5 Left 1157300467 18:46475215-46475237 CCGCAGGAGTCTGAAACCCTGGG No data
Right 1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG No data
1157300463_1157300473 7 Left 1157300463 18:46475203-46475225 CCTCTCTTCCTCCCGCAGGAGTC No data
Right 1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG No data
1157300464_1157300473 -1 Left 1157300464 18:46475211-46475233 CCTCCCGCAGGAGTCTGAAACCC No data
Right 1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG No data
1157300461_1157300473 13 Left 1157300461 18:46475197-46475219 CCTTCACCTCTCTTCCTCCCGCA No data
Right 1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG No data
1157300465_1157300473 -4 Left 1157300465 18:46475214-46475236 CCCGCAGGAGTCTGAAACCCTGG No data
Right 1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG No data
1157300460_1157300473 20 Left 1157300460 18:46475190-46475212 CCTGCTGCCTTCACCTCTCTTCC No data
Right 1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157300473 Original CRISPR CTGGGTCACCAAAAGGCAGG AGG Intergenic
No off target data available for this crispr