ID: 1157303439

View in Genome Browser
Species Human (GRCh38)
Location 18:46497906-46497928
Sequence CAGGATGCACAGTGGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157303434_1157303439 3 Left 1157303434 18:46497880-46497902 CCACAGACAGGCAGATATAATCA 0: 1
1: 0
2: 1
3: 12
4: 190
Right 1157303439 18:46497906-46497928 CAGGATGCACAGTGGGAGTTAGG 0: 1
1: 0
2: 2
3: 22
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157303439 Original CRISPR CAGGATGCACAGTGGGAGTT AGG Intronic
900616957 1:3569761-3569783 CAGGCAGCACAGGGGCAGTTGGG + Intronic
900680050 1:3911669-3911691 CAGGAGGCCCAGCGGGACTTGGG + Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902859206 1:19232639-19232661 CAGGGTGCACTGTGGGGGATGGG + Exonic
903041031 1:20530799-20530821 CTGCTTTCACAGTGGGAGTTGGG + Intergenic
904239054 1:29132284-29132306 CAGGCTGGACCTTGGGAGTTGGG + Intergenic
905263891 1:36738149-36738171 CTGGAGGCAGAGGGGGAGTTAGG + Intergenic
905797509 1:40823934-40823956 CAGGGTGGACAGTGGGAGACTGG - Intronic
915695690 1:157739482-157739504 CATGCTCCACAGTGGGAGGTGGG + Intergenic
917199461 1:172499729-172499751 CAGGATCAACAGAGGGACTTAGG - Intergenic
917449874 1:175138541-175138563 CAGGATTCTGAGTAGGAGTTGGG + Intronic
919761612 1:201101696-201101718 CAGGATGAACAGGGGGATCTGGG + Intronic
919796072 1:201322280-201322302 CAGGGTGCACTCTGGGAGCTGGG + Intronic
920305413 1:205015311-205015333 CAGGATGAGCAGTGGGAGTCTGG - Intronic
920383349 1:205548749-205548771 CAAGCTGCACAGTGGAAGCTGGG + Intergenic
921186951 1:212678440-212678462 CAGGACGCTCAGTGTGCGTTGGG - Intergenic
921521623 1:216162772-216162794 AAGGATGCACACATGGAGTTTGG - Intronic
922800983 1:228364668-228364690 CAGGAGGCAGAGTGAGAGTGAGG - Intronic
922891052 1:229062242-229062264 CAGGATGGGCAGTGAGAGGTGGG + Intergenic
922931965 1:229396966-229396988 CAGGAGGCAGAGGGGGAGTGAGG - Intergenic
923042970 1:230332974-230332996 CAGCATGGACAGTGGGAGGCCGG + Exonic
923288633 1:232522027-232522049 CAGGATGAGCACTGGGTGTTTGG - Intronic
923328792 1:232903523-232903545 CATGATGGGCAGTGGGAGTCAGG - Intergenic
1063482171 10:6385474-6385496 CAGGAAGCAAAGCGGGAGTGGGG - Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063554700 10:7067141-7067163 CTGGAAGAACAGTGAGAGTTAGG + Intergenic
1065549529 10:26856774-26856796 CAGGATGCAGATTGGTAGGTTGG - Intronic
1066044942 10:31586752-31586774 CAGGATGCAGAGTGAGAGGGTGG + Intergenic
1067583119 10:47457981-47458003 CAGGCTGGACAGTGGGTGATTGG - Intergenic
1068118464 10:52760325-52760347 CAAGATGGGCAGGGGGAGTTTGG - Intergenic
1069032924 10:63617123-63617145 CAGCATGCACAGAGGCAGTGAGG - Intronic
1069773865 10:70915649-70915671 TAGGAGGCAGAGTGGGAGGTCGG - Intergenic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070162881 10:73876329-73876351 CAGGACGCCCACTGGGAGTCGGG + Intergenic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070813147 10:79308336-79308358 CAGGAAGAACAGTTGGAGTTTGG + Intronic
1071494530 10:86158707-86158729 CAGGGTGCACAGTCTGAGTGGGG - Intronic
1072362864 10:94676987-94677009 CAGAAGGGAGAGTGGGAGTTGGG - Intergenic
1073690447 10:105802337-105802359 GAGGATGCCCAGTGGCAGTGAGG - Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074545515 10:114399314-114399336 GAGGGTACACAGTGGGAGTCAGG + Intronic
1075584631 10:123648691-123648713 CAGGCTGGAAAGTGGGACTTTGG + Intergenic
1076394652 10:130129758-130129780 CAGGCTGCGCAGTGGGAGAAGGG - Intergenic
1078338325 11:10481491-10481513 CAGGAGACACAGGAGGAGTTAGG - Intronic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1079640976 11:22805044-22805066 TAGGTTAAACAGTGGGAGTTTGG + Intronic
1082926312 11:58551087-58551109 CAGGATGCACAATGGCCCTTGGG + Exonic
1083406860 11:62463593-62463615 CAGCACGCACAGTGGGATGTAGG - Intronic
1083668200 11:64286415-64286437 CAGGGTGCAGAGAGGGAGATGGG - Intronic
1084771984 11:71349307-71349329 CAGCAGACACTGTGGGAGTTGGG + Intergenic
1086338771 11:85826230-85826252 CAGGATGCACAGGAGGACTGAGG + Intergenic
1086844334 11:91730180-91730202 GAGGAAGCACAGTGGGAGTGAGG + Intergenic
1087144379 11:94797795-94797817 AAGGATTGCCAGTGGGAGTTGGG + Intronic
1088693041 11:112344052-112344074 CTGGAGGCACAGTGGGGGTGGGG + Intergenic
1088875863 11:113935797-113935819 CAGGCTGCCCAGCGGGAGGTTGG + Intronic
1090277703 11:125431478-125431500 CAGGAAGCACCGAGGGAGTTGGG + Exonic
1090446067 11:126765877-126765899 CAGGTAGCAAATTGGGAGTTGGG - Intronic
1092594344 12:9985226-9985248 CATGATGGAAAGTGGGAGGTGGG - Exonic
1092725933 12:11485655-11485677 CAGGCTGCATAGCGGGAGGTGGG - Intronic
1093472473 12:19517615-19517637 CGGCATGCACAGTGGGAGTGGGG - Intronic
1093546980 12:20360059-20360081 CAGAAGGCACAGGGGGAGTGAGG + Intergenic
1095371001 12:41467183-41467205 CAGTAGACACAGTGAGAGTTTGG + Intronic
1100710031 12:97245934-97245956 CAGGATGCACTTTGGAATTTTGG + Intergenic
1100721986 12:97368959-97368981 ATGGGTGCACAGTGGGAGTCCGG - Intergenic
1101876272 12:108598479-108598501 CAGGGTGCAGCGTGGGAGCTGGG + Intergenic
1102114991 12:110396141-110396163 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1102506584 12:113388003-113388025 CAGGAATCACAGTCGGAATTGGG + Intronic
1104799511 12:131544184-131544206 GAGGAGGCACAGGGGGAGTGGGG - Intergenic
1109006434 13:56883283-56883305 TAGGAAGCCCAGTGAGAGTTAGG - Intergenic
1110565722 13:76955874-76955896 CAGGATGAACAGTCAGAGTAAGG - Intronic
1112099015 13:96166771-96166793 TAGGATTCACAGTGAGATTTGGG - Intronic
1113399704 13:109979555-109979577 CAGGATGCACTGTGGGTCCTGGG + Intergenic
1113438556 13:110311221-110311243 CAGGCTGCCCCGTGGGATTTCGG - Intronic
1114866579 14:26601789-26601811 CAGGAAGCACAGTAGGACATGGG + Intergenic
1115372813 14:32637720-32637742 GAGGGTGGAGAGTGGGAGTTGGG + Intronic
1115408594 14:33047347-33047369 CAGCATGCACAATGGGGATTTGG - Intronic
1117030286 14:51661893-51661915 TAGGATGTGCAGTGGGACTTTGG + Intronic
1118371477 14:65140880-65140902 CACCATGCACAGTTGGATTTAGG + Intergenic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1120981490 14:90293001-90293023 CAGGATACTCAGTGGCATTTAGG + Intronic
1121448526 14:93993539-93993561 CAGGATGCAGAGTGGGGCTGCGG - Intergenic
1121795621 14:96732981-96733003 AAGGACCCACAGTTGGAGTTAGG + Intergenic
1122918671 14:104870655-104870677 CAGGGTGCTCAGGGTGAGTTTGG + Intronic
1125341335 15:38678460-38678482 CATGATGGAAAGGGGGAGTTGGG + Intergenic
1126729800 15:51671346-51671368 CAAGGTGGACAGTGGAAGTTAGG - Intergenic
1127282172 15:57501833-57501855 CAGGATCCACGGTGGCAGTCAGG - Intronic
1127721676 15:61707969-61707991 CAGGAAGCAGGGTGGGTGTTGGG + Intergenic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1128345678 15:66851045-66851067 CAGGATGCCCAGTTGGATTTGGG + Intergenic
1130026569 15:80275963-80275985 CAGGATGCATAGGGAGGGTTTGG + Intergenic
1130536851 15:84791874-84791896 CAGGATGAATTGTGGGAGTGGGG + Intronic
1131856852 15:96606254-96606276 TGGGAAGCAGAGTGGGAGTTTGG + Intergenic
1134691905 16:16196591-16196613 CAGGAGGCACAGAGAGAGTAGGG + Intronic
1135801575 16:25502034-25502056 GAGGCAGCACTGTGGGAGTTTGG + Intergenic
1135940317 16:26816731-26816753 CAGGATGGACAGAGGGAGAGGGG - Intergenic
1136861957 16:33709993-33710015 CAGGAACCACAGTGGGTGTGGGG - Intergenic
1138481567 16:57306822-57306844 CAGGATGCACTGTGGTTGTGGGG - Intergenic
1139392551 16:66614178-66614200 CAGGCTGCACAGCAGGAGGTGGG - Intergenic
1139531450 16:67544598-67544620 CAGCATGCACTGGGGGAGGTTGG - Intronic
1140541241 16:75758356-75758378 TAGCATGCTCAGTGGGAGGTGGG + Intronic
1140936936 16:79680854-79680876 GAGGTTGGACAGTGGGAGGTGGG + Intergenic
1141622115 16:85241880-85241902 CAGGATGCCCAGTGTGGGCTGGG - Intergenic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1141986479 16:87583747-87583769 CAAGAAGCACAGTGGGAGAGTGG + Intergenic
1142144325 16:88486519-88486541 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144353 16:88486657-88486679 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1203123445 16_KI270728v1_random:1558176-1558198 CAGGAACCACAGTGGGTGTGGGG - Intergenic
1143141982 17:4745906-4745928 CAGGAGGAGCAGAGGGAGTTGGG - Exonic
1143730562 17:8880513-8880535 CAGGACCCACAGTGGGACTATGG + Exonic
1143968986 17:10778832-10778854 CAGGACCTACAGTGGGTGTTGGG - Intergenic
1144738728 17:17569354-17569376 CAGGGTGCACTGTGGGAGAGAGG + Intronic
1144742205 17:17590313-17590335 CAGGAGGCACAGGAGGAGATGGG - Intronic
1145809294 17:27755111-27755133 CAGGGTGCAAGGTGAGAGTTAGG - Intergenic
1146478526 17:33182778-33182800 CACTCTGCACAGTGTGAGTTAGG + Intronic
1148393443 17:47290098-47290120 CAGGACTCTCAGTGGGATTTGGG + Intronic
1148469209 17:47883165-47883187 CAGGAGGGTCAGTGAGAGTTTGG + Intergenic
1149500814 17:57150951-57150973 CAGGCTGGGCAGTGGGAGTTGGG - Intergenic
1151699506 17:75735843-75735865 CAGGCTGCAGAGTGGAAGGTAGG + Intronic
1154036703 18:10810317-10810339 CAGGTTCCAAAGTGGGAGTGTGG - Intronic
1156131927 18:33987035-33987057 CAGAATGGAAAGTGGGAATTTGG + Intronic
1157303439 18:46497906-46497928 CAGGATGCACAGTGGGAGTTAGG + Intronic
1157351435 18:46890646-46890668 CAGGATGGACAGGAGGAATTGGG + Exonic
1159002224 18:62984498-62984520 TAGTTTGCACAGTGTGAGTTAGG - Intergenic
1160210443 18:76873927-76873949 CAGGAGGCACAGTGAGAGTGTGG - Intronic
1160210473 18:76874069-76874091 CAGGAGGCACAGTGAGAGTGTGG - Intronic
1160210490 18:76874141-76874163 CAGGAGGCACAGTGAGAGTGTGG - Intronic
1160282195 18:77501572-77501594 CAGGCTGCACAGTGGGGTTTTGG + Intergenic
1160835148 19:1121524-1121546 CAGGGTGCACCTTGGGTGTTGGG - Intronic
1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG + Exonic
1161265932 19:3364606-3364628 CAGGATGCATCTTGGGAGGTGGG - Intronic
1161674618 19:5638188-5638210 GAGGTTGCACAAGGGGAGTTGGG + Intronic
1161911444 19:7197494-7197516 CAGGTTCCAGAGTGGGAGTGGGG + Intronic
1161983687 19:7643139-7643161 CAGGGTGCAGGGTGGGGGTTGGG - Intronic
1162321523 19:9973627-9973649 CAGGAGGCAAAGTGAGAGTGGGG + Intronic
1162776965 19:12985758-12985780 CAGGCTGCACAGGGAGAGCTGGG + Intergenic
1163005268 19:14393479-14393501 CAGGATTCACAGGGGCAGATGGG + Intronic
1164810656 19:31152738-31152760 AAGGAAGCACAGAGGAAGTTAGG - Intergenic
1164843728 19:31414155-31414177 CAGAATGCACAGAGAGAGATGGG + Intergenic
1165071825 19:33260410-33260432 CAGGACTCACTGTGGGTGTTTGG - Intergenic
1166895102 19:46017999-46018021 CAGGATTTCCAGTGGGATTTAGG + Intronic
1167099043 19:47392709-47392731 CAGAACTTACAGTGGGAGTTTGG - Intergenic
1167494528 19:49809758-49809780 CAGACTTCACAGTGTGAGTTGGG - Intronic
924971893 2:135983-136005 CAGGAAGCACAGTGGCATCTGGG - Intergenic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
927606156 2:24489314-24489336 CGGGCTGCAGAGTGGGAGATTGG + Intergenic
927737934 2:25538868-25538890 GAGGAGGCAGAGTGGGAGTGGGG - Intronic
927879500 2:26680745-26680767 CAGGATTCAGAGTTGAAGTTGGG + Intergenic
928165598 2:28969477-28969499 CAGGAGGCCCAATGGGACTTGGG + Intronic
928756636 2:34534191-34534213 GTGGAGGCACAGTAGGAGTTGGG - Intergenic
928982919 2:37155140-37155162 CAGGTTGGACAGAGGCAGTTGGG - Intronic
929544986 2:42849840-42849862 CAGGGTGCACAGTGGAAGGGAGG - Intergenic
929785541 2:44988229-44988251 CAGAAGGCAAAGTGGGAGTAAGG + Intergenic
930002232 2:46869222-46869244 CAGGAGGCACACAGGGAGCTTGG - Intergenic
930952469 2:57159806-57159828 GAGGATGAAAAGTTGGAGTTGGG - Intergenic
932485859 2:72083952-72083974 CAGGCTGCGGAGTGGGACTTGGG + Intergenic
937201982 2:120209748-120209770 CAGGCTGCAGAGTGGGAGATGGG + Intergenic
940143315 2:150519676-150519698 CAGGATGGATGGAGGGAGTTAGG + Intronic
940642999 2:156366818-156366840 CAGGATGCACAGAGTGAGAGAGG + Intergenic
942910959 2:181244231-181244253 CATTATGCACAGTGGTTGTTAGG - Intergenic
944709063 2:202319489-202319511 CAGGAAGCAAAGTGGGATATGGG + Intergenic
945460289 2:210100068-210100090 CAGGCTGCACAGCAGGAGGTGGG + Intronic
945754467 2:213829641-213829663 TAGTATGCACTGTGGGACTTGGG - Intronic
946217751 2:218198805-218198827 CAGGATACACTGTTGGAGTCAGG + Intergenic
948870700 2:240796482-240796504 CAGGATGCACTGTGGGAGATTGG - Intronic
1168855583 20:1005443-1005465 CAAGATGCTCAGAGGGTGTTTGG + Intergenic
1168898567 20:1340923-1340945 CAGCAGGCAGAGGGGGAGTTAGG - Intronic
1170029840 20:11933193-11933215 CAGGTTGAACACTGTGAGTTGGG - Intergenic
1172274470 20:33672325-33672347 CAGGAGGCCCAGGGAGAGTTGGG - Intronic
1174062984 20:47845597-47845619 CGGTCTGCACAGTGGGAGGTTGG + Intergenic
1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG + Intergenic
1177132724 21:17277667-17277689 CAGGAAGGACAGTGGGAGTCTGG + Intergenic
1177245852 21:18522142-18522164 GATGATGTACAGTGGGAGTGAGG + Intergenic
1178251113 21:31004237-31004259 AAGGATGCTCAGAGGGAGGTTGG - Intergenic
1178355191 21:31905546-31905568 CAGGGAGCTCAGTGGGAGGTGGG - Intronic
1178450411 21:32693217-32693239 CATGATCAACAGTGGGTGTTTGG - Intronic
1178704427 21:34861622-34861644 GAGGGTGCACACTGGGAGTCAGG - Intronic
1179739695 21:43411202-43411224 CAGGGTGCACAGTGGGCCCTGGG - Intergenic
1181796140 22:25312394-25312416 CAGGGAGTACAGTGGGAGTTGGG + Intergenic
1181836686 22:25616004-25616026 CAGGGAGTACAGTGGGAGTTGGG + Intronic
1182685626 22:32120382-32120404 CAGGAAGCACAGTGGGTCTAGGG + Intergenic
1183327752 22:37203653-37203675 CAGGGTGCACAGTAGGTGGTCGG - Intergenic
1183748799 22:39707444-39707466 CAGGATGCTCAGTGAGAGCCGGG + Intergenic
949944715 3:9180770-9180792 CAGGATCTACAGTGGGAACTGGG - Intronic
953502116 3:43446929-43446951 CAGGAGGCACAGTGGGGCATTGG - Intronic
954213687 3:49112359-49112381 CAGGCTGCACACTTGGAGATGGG + Exonic
954662203 3:52232153-52232175 CGGGAGGCGCAGTGGGAGCTGGG - Intronic
955884964 3:63588332-63588354 CAGGAGACACAGTGGAAGGTTGG - Intronic
956481255 3:69675920-69675942 CAGGAAGCATAGAGGGAGCTTGG - Intergenic
957789028 3:84916768-84916790 TAGGATTCACAGTGGGACTGAGG - Intergenic
958818547 3:98946410-98946432 CAGCATACAAAGTGGGAGGTAGG + Intergenic
959073041 3:101721099-101721121 TAGGATGAACGGTGGGAGGTAGG + Intergenic
959098817 3:101987141-101987163 CATGATGGAAAGTGGGATTTAGG + Intergenic
959705439 3:109335037-109335059 AAGGAAGCAAAGTGGGAGTGGGG + Intronic
960622954 3:119654014-119654036 CAGGCTTCACAGTGGAAGTGAGG + Intronic
960750636 3:120948550-120948572 CAGGAGGAAGGGTGGGAGTTGGG - Intronic
961645790 3:128392180-128392202 CGGGACCCAGAGTGGGAGTTAGG + Intronic
961957504 3:130819165-130819187 CAGGATGCAGGGTGGGGGCTGGG - Intergenic
962382815 3:134911093-134911115 CAGGATGCAAGGTGGAAGTCTGG - Intronic
963774844 3:149428369-149428391 CAAGATGCACAGTGTGAATCTGG - Intergenic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
975129525 4:70818742-70818764 CAGGAAGAATAGTGGGAGTGGGG - Exonic
977686672 4:99854622-99854644 CAGGTTTCACAGTGTGAGTGTGG - Intronic
979459969 4:120970868-120970890 CAGGATTCACTCTCGGAGTTTGG - Intergenic
982204290 4:152985382-152985404 ACAGATTCACAGTGGGAGTTAGG + Intergenic
985415473 4:189732013-189732035 CAGGATGCAGAGGAAGAGTTTGG - Intergenic
985525845 5:401263-401285 CCTGAGGCACAGTGGTAGTTTGG + Intronic
985733653 5:1565225-1565247 CAGGATGCCCATGGGGCGTTTGG - Intergenic
990240451 5:53811528-53811550 CAGGCAGAACAGTGAGAGTTAGG - Intergenic
990510173 5:56482286-56482308 CCTGATGCTCAGTGGCAGTTTGG + Intergenic
992654469 5:78894836-78894858 GGGCATGCACAGTGGGAGTGAGG + Intronic
992738729 5:79751285-79751307 CAGAGGGCACCGTGGGAGTTGGG - Intronic
994581494 5:101648438-101648460 CAGGCTGCACAATAGGAGGTGGG - Intergenic
995740178 5:115347809-115347831 CAGGAGGAACAGTTGGATTTGGG + Intergenic
995827695 5:116319188-116319210 CATGAAACACAGTAGGAGTTTGG + Intronic
996713732 5:126569049-126569071 CAGGCTGCACAGCAGGAGGTAGG + Intronic
996758810 5:126966171-126966193 CTGGAGGCAAAGTGGGTGTTGGG + Intronic
997415406 5:133724105-133724127 CAGGGGGCACAGTGGAGGTTGGG + Intergenic
997669155 5:135656290-135656312 CAGGATGGCCAGTGTGAGATGGG - Intergenic
997992527 5:138557337-138557359 CAGTCTTGACAGTGGGAGTTTGG - Intronic
999818481 5:155200834-155200856 CGGGGAGCACAGTGGGAGTGAGG + Intergenic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
999997246 5:157103863-157103885 CAGGAGGCACAGTGAGATTGTGG - Intronic
1001350917 5:170963734-170963756 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1002528000 5:179825747-179825769 CAGGTTGCACAGTGGGTCTGTGG + Intronic
1003067790 6:2918329-2918351 AAGGAAGCCCAGTGGGAGTGGGG + Intergenic
1005812737 6:29529410-29529432 CAGGCTGGGCAGTGGCAGTTGGG - Intergenic
1006457282 6:34139103-34139125 CAAGAAGCACAGTGGGGGTCTGG + Intronic
1007097043 6:39219784-39219806 CAGGATGCTCAGTGAGTGTGTGG - Intronic
1007109980 6:39307743-39307765 CAAGATGCAAAGTGGCAGTGAGG - Intronic
1007524593 6:42480730-42480752 CAGGAAGCACAGTGAGAGGCTGG - Intergenic
1007906318 6:45464872-45464894 CTTGATGCACAGTGGGATTGTGG + Intronic
1010671325 6:78690039-78690061 AAGGATTCACAGTGATAGTTTGG - Intergenic
1012643803 6:101654845-101654867 CAAGATGAAGAGTGGGAATTGGG - Intronic
1015074995 6:129145621-129145643 CAGGAGGTAGAGTGGGGGTTGGG + Intronic
1015088747 6:129329302-129329324 CAGCATGCAAAGTGAGAGTTGGG - Intronic
1015421785 6:133019382-133019404 CAGAAGGCAAAGTGGGAGTGAGG + Intergenic
1018718513 6:166554500-166554522 CAGGATGCACATCCGGAGCTGGG - Intronic
1022942012 7:35250128-35250150 CTGGATGCTCATGGGGAGTTTGG - Exonic
1023480531 7:40629026-40629048 CATGATGGACAGTGAGATTTGGG - Intronic
1028403215 7:90446847-90446869 AAGGATTCACAGTAGGAGATTGG - Intronic
1028473866 7:91232850-91232872 CAGGCTGGCCAGTGGGAATTTGG + Intergenic
1031554845 7:123161560-123161582 CAGAATGGACAGAGGGAGATGGG + Intronic
1032514888 7:132499539-132499561 CAGGAGGGACAGTGGGATTTGGG - Intronic
1034431588 7:151043805-151043827 GAGGATGCACAGTGCGGGGTGGG + Intronic
1035053396 7:156017666-156017688 CAGGATGCACAGAGCCAGGTGGG + Intergenic
1035055913 7:156036395-156036417 CAGGAGGCACACTGGGGGTTGGG - Intergenic
1036966287 8:13301711-13301733 CAGGCTGCACAGCAGGAGATGGG + Intronic
1037058509 8:14476661-14476683 TAGCATACACAGTGGGACTTGGG - Intronic
1037742490 8:21618574-21618596 CAGGCTGCACAGCAGGAGGTGGG + Intergenic
1038273222 8:26094349-26094371 CAGGGGGCACCGTGGGAGGTGGG - Intergenic
1038772984 8:30501278-30501300 CAGGATGCAGAAAGGGTGTTGGG - Intronic
1041711228 8:60896333-60896355 GAGGCTGAACAGTGGGAGTATGG - Intergenic
1042407351 8:68421482-68421504 CTGGATGTACAGTAGGAGTTGGG - Intronic
1044157195 8:88862311-88862333 CAGAAGGCAAAGTGGGAGTGAGG + Intergenic
1044908507 8:97030997-97031019 CAAGATGCACAGTGGTAGGAGGG + Intronic
1046731278 8:117728869-117728891 GAGAATGGACAATGGGAGTTAGG - Intergenic
1047415150 8:124658618-124658640 CAGAATGCAAAGAGGGAGCTAGG + Intronic
1048436083 8:134419164-134419186 GAGGATGGACAGTGGGAGGAGGG + Intergenic
1049246895 8:141567599-141567621 CAGGATGCACGGGGGCAGCTGGG + Intergenic
1049261558 8:141641746-141641768 CAGGAAGCACAGGGGCAGGTGGG + Intergenic
1049412277 8:142478616-142478638 TGGGGTGCACAGTGGGACTTGGG + Intronic
1049412298 8:142478680-142478702 CAGGGTGCACAGTGGGACTTGGG + Intronic
1049412315 8:142478740-142478762 CGGGGTGCACAGTGGGACTTGGG + Intronic
1049412329 8:142478804-142478826 TGGGGTGCACAGTGGGACTTGGG + Intronic
1049412348 8:142478868-142478890 TGGGGTGCACAGTGGGACTTGGG + Intronic
1049412380 8:142478996-142479018 CGGGGTGCACAGTGGGACTTGGG + Intronic
1049761758 8:144334814-144334836 CAGGATGGTGAGAGGGAGTTCGG - Intronic
1050593152 9:7180581-7180603 CAGGAGGCACGGTGTGAGGTAGG + Intergenic
1051689578 9:19696012-19696034 CAGGCTGCACAGCAGGAGGTGGG + Intronic
1051877289 9:21805990-21806012 ACGGATGCACAGTGAGAATTGGG + Intronic
1052183037 9:25554274-25554296 CAGGATGCTCAGTTGGAATCTGG - Intergenic
1052866075 9:33465396-33465418 CTGGATGAACAGTGGCAGTGGGG - Intronic
1054717448 9:68570472-68570494 AAGGGTGCTCAGTGGAAGTTGGG - Intergenic
1056201621 9:84282522-84282544 TAGGATGCCCAGTTGGAGGTAGG + Intronic
1057371706 9:94479881-94479903 CAGGAACCACAGTGGGTGTGGGG - Intergenic
1057498097 9:95575849-95575871 CAGGAAGCACAGGTGGAGTGGGG + Intergenic
1057698887 9:97348806-97348828 CAGGATGGGCAGGGGGTGTTGGG - Intronic
1058528864 9:105886365-105886387 CAGGAGACACAGAGGCAGTTGGG - Intergenic
1060760643 9:126245392-126245414 CAGAATGAGCACTGGGAGTTGGG + Intergenic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1186300289 X:8193372-8193394 CAGGGTGCAGGGTGGGAGTAGGG - Intergenic
1186989846 X:15055602-15055624 AAGGAGGCACAATGGGAGCTAGG - Intergenic
1188415305 X:29925833-29925855 CAAGAAGCACACAGGGAGTTGGG - Intronic
1190158193 X:48010518-48010540 CAGGAAGCTCAGTGGGAATCAGG + Intronic
1190173964 X:48133400-48133422 CAGGAAGCTCAGTGGGAATCAGG + Intergenic
1192560593 X:72125565-72125587 CAGGAAGCACTGTGGGAATGGGG - Intergenic
1193590617 X:83384584-83384606 CAGCATCCACTGTGGGAGATGGG - Intergenic
1193702415 X:84779569-84779591 CAGGGTGTACAATGGGAGTGTGG + Intergenic
1195066550 X:101242934-101242956 CAGGATGCCCACCGGGACTTTGG + Exonic
1197713274 X:129687477-129687499 CAGGAGGGGAAGTGGGAGTTTGG - Intergenic
1198472564 X:136961917-136961939 GAGGATGCCCAGCAGGAGTTTGG + Intergenic
1199789566 X:151139843-151139865 CAGGATACAAAATGGCAGTTGGG - Intergenic
1201334098 Y:12861204-12861226 CAGGTTACAGAGTGGTAGTTTGG - Intergenic