ID: 1157303667

View in Genome Browser
Species Human (GRCh38)
Location 18:46500101-46500123
Sequence ATGGAAAAGAAGGAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3388
Summary {0: 1, 1: 2, 2: 42, 3: 409, 4: 2934}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157303667_1157303672 6 Left 1157303667 18:46500101-46500123 CCCTCCTCTTCCTTCTTTTCCAT 0: 1
1: 2
2: 42
3: 409
4: 2934
Right 1157303672 18:46500130-46500152 ACCTCAAATGTTGAAATTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 224
1157303667_1157303674 7 Left 1157303667 18:46500101-46500123 CCCTCCTCTTCCTTCTTTTCCAT 0: 1
1: 2
2: 42
3: 409
4: 2934
Right 1157303674 18:46500131-46500153 CCTCAAATGTTGAAATTCTTGGG 0: 1
1: 0
2: 9
3: 37
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157303667 Original CRISPR ATGGAAAAGAAGGAAGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr