ID: 1157303672

View in Genome Browser
Species Human (GRCh38)
Location 18:46500130-46500152
Sequence ACCTCAAATGTTGAAATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 224}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157303669_1157303672 2 Left 1157303669 18:46500105-46500127 CCTCTTCCTTCTTTTCCATTATC 0: 1
1: 1
2: 8
3: 91
4: 1062
Right 1157303672 18:46500130-46500152 ACCTCAAATGTTGAAATTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 224
1157303670_1157303672 -4 Left 1157303670 18:46500111-46500133 CCTTCTTTTCCATTATCTCACCT 0: 1
1: 0
2: 5
3: 59
4: 561
Right 1157303672 18:46500130-46500152 ACCTCAAATGTTGAAATTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 224
1157303666_1157303672 7 Left 1157303666 18:46500100-46500122 CCCCTCCTCTTCCTTCTTTTCCA 0: 1
1: 2
2: 42
3: 439
4: 3091
Right 1157303672 18:46500130-46500152 ACCTCAAATGTTGAAATTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 224
1157303667_1157303672 6 Left 1157303667 18:46500101-46500123 CCCTCCTCTTCCTTCTTTTCCAT 0: 1
1: 2
2: 42
3: 409
4: 2934
Right 1157303672 18:46500130-46500152 ACCTCAAATGTTGAAATTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 224
1157303663_1157303672 26 Left 1157303663 18:46500081-46500103 CCCTTCTCTTTTCTTCTTCCCCC 0: 1
1: 3
2: 32
3: 298
4: 2461
Right 1157303672 18:46500130-46500152 ACCTCAAATGTTGAAATTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 224
1157303664_1157303672 25 Left 1157303664 18:46500082-46500104 CCTTCTCTTTTCTTCTTCCCCCT 0: 1
1: 5
2: 27
3: 298
4: 2639
Right 1157303672 18:46500130-46500152 ACCTCAAATGTTGAAATTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 224
1157303662_1157303672 27 Left 1157303662 18:46500080-46500102 CCCCTTCTCTTTTCTTCTTCCCC 0: 1
1: 3
2: 27
3: 279
4: 2540
Right 1157303672 18:46500130-46500152 ACCTCAAATGTTGAAATTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 224
1157303665_1157303672 8 Left 1157303665 18:46500099-46500121 CCCCCTCCTCTTCCTTCTTTTCC 0: 2
1: 49
2: 450
3: 3259
4: 12695
Right 1157303672 18:46500130-46500152 ACCTCAAATGTTGAAATTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 224
1157303668_1157303672 5 Left 1157303668 18:46500102-46500124 CCTCCTCTTCCTTCTTTTCCATT 0: 1
1: 2
2: 28
3: 339
4: 2871
Right 1157303672 18:46500130-46500152 ACCTCAAATGTTGAAATTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157303672 Original CRISPR ACCTCAAATGTTGAAATTCT TGG Intronic
903840168 1:26233504-26233526 ATCTCAGATAGTGAAATTCTGGG - Intergenic
904337563 1:29808113-29808135 CCCTCAGATGTAGAGATTCTGGG - Intergenic
906543339 1:46604646-46604668 AACTCTTATGGTGAAATTCTAGG - Intronic
906831078 1:49032673-49032695 ACCTCATATGTTGTAACCCTTGG + Intronic
908810244 1:67974925-67974947 CCCTCACATGCTGGAATTCTGGG + Intergenic
909399656 1:75212892-75212914 TCCTCAATTGTTGGAAATCTAGG + Intronic
909473559 1:76056714-76056736 TCCTAAAATGTTGGAATTATAGG + Intergenic
912660394 1:111523719-111523741 ATCTAAATTGTTGAATTTCTTGG + Intronic
913464125 1:119121921-119121943 ACCTCAAACCTAAAAATTCTAGG + Intronic
913579998 1:120216831-120216853 TCCTGAAGTGTTGAAATTATAGG + Intergenic
913628176 1:120681561-120681583 TCCTGAAGTGTTGAAATTATAGG - Intergenic
914561928 1:148828263-148828285 TCCTGAAGTGTTGAAATTATAGG + Intronic
914610902 1:149301950-149301972 TCCTGAAGTGTTGAAATTATAGG - Intergenic
917057468 1:170998873-170998895 ACCTCAAAGTTTGAAAGTATTGG - Intronic
918535864 1:185573745-185573767 AACTGAAATGTTGAAATTCAGGG + Intergenic
918790452 1:188819882-188819904 AACCCAAAGGTTGAATTTCTAGG + Intergenic
918913599 1:190606136-190606158 ACCAAAAGTGTTGAGATTCTAGG - Intergenic
918978557 1:191524865-191524887 ACCTGAAATGTTGGGATTATAGG - Intergenic
919213272 1:194516700-194516722 CCCTCACTTGTTGAATTTCTTGG - Intergenic
920656883 1:207883499-207883521 ACCCCAAATGTTTAAATCTTGGG - Intergenic
921755596 1:218852543-218852565 TCTTCAAATATTGAAATCCTGGG + Intergenic
922068601 1:222168841-222168863 ACCTCCAATGTTGGAAGTGTGGG + Intergenic
924265988 1:242282806-242282828 CCCTAAAATGTTGAAATTCCTGG - Intronic
924638539 1:245811443-245811465 ATTTGAAATGTTGAAAGTCTTGG + Intronic
1063273113 10:4534399-4534421 ACCTCTAATGCTAAAATTCTAGG + Intergenic
1064772792 10:18741232-18741254 ACCTCAACTATAGAAATTCATGG - Intergenic
1066718846 10:38315731-38315753 CCCTAAAATGTTGAAATTCCTGG + Intergenic
1069667792 10:70175297-70175319 TCCCCAAATGTTGAGATTATGGG + Intergenic
1069850195 10:71399083-71399105 ACCTCAAATGGTGAAACTGCAGG - Intronic
1070404392 10:76082103-76082125 AGATCAAAAATTGAAATTCTCGG + Intronic
1070821602 10:79358854-79358876 TCCTAAAATGTTGAGATTATAGG + Intergenic
1071166302 10:82811452-82811474 TCCTGCAATGGTGAAATTCTGGG + Intronic
1072884274 10:99260068-99260090 AACAAAAATCTTGAAATTCTGGG - Intergenic
1073068208 10:100776676-100776698 ACCTCAAATGCTGCACATCTAGG + Intronic
1073923941 10:108492040-108492062 ACCTCATATGTTGGAGTTATTGG + Intergenic
1076034745 10:127190032-127190054 AACCCAAATGCTGACATTCTGGG - Intronic
1076517886 10:131059489-131059511 ACTTAAAATGCTAAAATTCTAGG + Intergenic
1077826507 11:5815099-5815121 ACCTAAAATTATGAAACTCTTGG + Intronic
1078693528 11:13606022-13606044 ACCTCAAATTATGAAACTCTGGG - Intergenic
1081048054 11:38300565-38300587 ACAACAAATATTGAAATTTTGGG - Intergenic
1081239615 11:40688495-40688517 GCATCAAATGTTGAAAGCCTTGG + Intronic
1082123905 11:48410009-48410031 TCCTCAAAGGTGCAAATTCTGGG + Intergenic
1082918427 11:58464972-58464994 ATCTCAAAAGTCTAAATTCTAGG + Intergenic
1087129800 11:94658809-94658831 AAACCAAATATTGAAATTCTTGG + Intergenic
1088481308 11:110298455-110298477 AACTAAAATGTTGCAATTTTTGG - Intergenic
1091862495 12:3798495-3798517 CTGTCAAATGTTGAACTTCTGGG - Intronic
1092643675 12:10545919-10545941 GCCTCTAATTTTGAAATTATTGG + Intergenic
1093204968 12:16237720-16237742 ACCACAAATTTTAAAATTTTGGG - Intronic
1093955163 12:25208539-25208561 AACTCAAAAGTTGAGATTTTGGG - Intronic
1095799433 12:46256916-46256938 ACACCACATGTTGAAACTCTTGG - Intronic
1095900219 12:47320335-47320357 ACTACAAATGTTGCCATTCTTGG + Intergenic
1096353299 12:50917833-50917855 ACCTTAAACCTTAAAATTCTTGG + Intergenic
1096762013 12:53849628-53849650 AGCTAGAATGTTGAAGTTCTAGG - Intergenic
1097023510 12:56036937-56036959 ACCTCACAAGTTGTAACTCTTGG + Exonic
1099561155 12:84175065-84175087 AATTCAAAGGTTGAAATTATGGG - Intergenic
1099673412 12:85724868-85724890 ACCTTATTTGTTGAATTTCTAGG + Intergenic
1100307680 12:93366070-93366092 ACCACAAATCCTTAAATTCTAGG + Intergenic
1101374737 12:104161603-104161625 ACCTAAATTGTTGAATTTATTGG + Intergenic
1101934191 12:109043604-109043626 ACCTAAAATGATAAAACTCTTGG + Intronic
1104080259 12:125424000-125424022 TCCACAAATCTTGAAATTGTTGG - Intronic
1104129960 12:125884124-125884146 CCCCCAAAAGTTGAAATTCTCGG + Intergenic
1104518845 12:129454101-129454123 ACCTCAAAGAATTAAATTCTGGG - Intronic
1109207085 13:59494594-59494616 ACCTGAAATGTTCTAATTATTGG + Intergenic
1109589430 13:64459004-64459026 CTCTCAAATGTTGGAGTTCTTGG + Intergenic
1112012724 13:95305467-95305489 TCCCAAAATGTTGAAATTATAGG - Intergenic
1113421292 13:110173524-110173546 CCCTCAAATGGGGAAATGCTGGG + Intronic
1115803827 14:37028677-37028699 ACAACAAATATTGAAATTATAGG + Intronic
1116541832 14:46109549-46109571 ACCTCAACAGTTGCAATTCCTGG + Intergenic
1116886656 14:50228753-50228775 ACCTCAAATTTTAGAATTTTTGG + Intronic
1117265696 14:54084139-54084161 CTCTCAAATGTGGACATTCTGGG - Intergenic
1117395789 14:55308601-55308623 ACCTCAAATCTAGCAATACTTGG - Intronic
1118370993 14:65137001-65137023 TCCTCAGATGATGAAAGTCTCGG - Intergenic
1120727755 14:87964042-87964064 GCCTTGAATGTTGAAATTGTTGG - Intronic
1120939464 14:89933327-89933349 CACTAAAATGTTTAAATTCTTGG - Intronic
1122160298 14:99779481-99779503 TTCTCAAATGTTCAGATTCTTGG + Intronic
1124936326 15:34175199-34175221 ACCTGAAATCATGAAATGCTTGG + Intronic
1126349843 15:47733416-47733438 ATTTCAAATATTGAAAATCTAGG - Intronic
1126925638 15:53583214-53583236 ACATCAAATGAAGTAATTCTTGG - Intronic
1127654075 15:61039313-61039335 ACCTCAAATGTTAGAAATGTTGG + Intronic
1128195139 15:65746708-65746730 AAATCAAATGCTGACATTCTTGG + Intronic
1133498069 16:6339202-6339224 TCCTCAATTGTGGAAATCCTGGG - Intronic
1134864943 16:17597536-17597558 TCATCAAATATTGAAATTCTGGG - Intergenic
1135608984 16:23848306-23848328 GACTCAAATCCTGAAATTCTAGG + Intronic
1135871217 16:26152317-26152339 ACTTCAATTTTTGAAATTATTGG - Intergenic
1137333468 16:47525114-47525136 CCCTAAAATCTTGAAATCCTGGG + Intronic
1138747247 16:59377496-59377518 AATTCATATGTTGAAACTCTGGG - Intergenic
1146051068 17:29553901-29553923 AGTTCAAATGTCGACATTCTAGG - Intergenic
1146700858 17:34958597-34958619 ACTTCAAATGTTCTAATTATTGG - Exonic
1148199034 17:45736028-45736050 ACCTCAAAATTTAAAATTTTAGG - Intergenic
1150968862 17:70003774-70003796 ACTCCACAAGTTGAAATTCTGGG + Intergenic
1152860704 17:82695584-82695606 TCCTCAAATGCTGAGATTATAGG - Intronic
1153185412 18:2480659-2480681 TGCTCTAATGTTGAAAGTCTCGG + Intergenic
1156612715 18:38745559-38745581 ATCTAAACTGTTGAAATACTAGG - Intergenic
1157090073 18:44626684-44626706 ACCTCAACTATTGATATTATTGG + Intergenic
1157303672 18:46500130-46500152 ACCTCAAATGTTGAAATTCTTGG + Intronic
1158274517 18:55752361-55752383 AATTCAAATTTTGTAATTCTTGG + Intergenic
1158351278 18:56567005-56567027 ACCTAAAATGCTGATTTTCTTGG - Intergenic
1161122301 19:2535823-2535845 AGTTCATATGTTGAAATCCTGGG + Intronic
1164392660 19:27839389-27839411 ATGTCAAATATTGAAATTCCAGG + Intergenic
925295090 2:2771029-2771051 TCCTAAAATGCTGAGATTCTAGG + Intergenic
925898596 2:8492718-8492740 ACCTCCAGTGTTTAGATTCTGGG - Intergenic
927913533 2:26918316-26918338 ACCTCACTTGATGAAATGCTTGG + Intronic
930170346 2:48245405-48245427 AATTCATATGTTGAAATCCTAGG + Intergenic
932117342 2:69064845-69064867 CCCACAAATGTTGATATGCTGGG - Intronic
932936837 2:76113327-76113349 CCCTAAAATTTTGAAATTCTGGG - Intergenic
935920842 2:108012067-108012089 ACATCAAATGTTAAAATTGATGG - Exonic
936681990 2:114784571-114784593 ATCTCTAATGCTGGAATTCTAGG + Intronic
937302662 2:120852680-120852702 ACCTATAATGGTGGAATTCTAGG - Intronic
937469495 2:122163120-122163142 ACCTCAAATGTAGGCATTTTTGG + Intergenic
938186473 2:129236624-129236646 ACCTGAAATGTGGAAATACCTGG + Intergenic
942109865 2:172670272-172670294 ACCTAAAATTTTCATATTCTAGG + Intergenic
942118399 2:172751300-172751322 ACCTCACGAATTGAAATTCTAGG + Intronic
942352140 2:175064337-175064359 ACCTCAAGTGATAAAATGCTGGG - Intergenic
942522871 2:176822634-176822656 ACCTCAAGTTTTGAAGTTCCAGG + Intergenic
942700402 2:178701499-178701521 AGCTCAGATGTTGAGGTTCTGGG + Intronic
943851770 2:192732525-192732547 ACCTCAAAGAATGAAAATCTAGG + Intergenic
944015997 2:195038558-195038580 ACTTCAAAAGTTGCAATTCTGGG - Intergenic
945405029 2:209435679-209435701 ACACCATATGTAGAAATTCTAGG - Intronic
947159665 2:227199666-227199688 ATCTTAAATATTGAGATTCTTGG + Intronic
948416922 2:237814408-237814430 ACATTAAATGTTGGAAATCTAGG + Intronic
948965963 2:241380803-241380825 ACTTCAAATGTCTACATTCTTGG + Intronic
1169019656 20:2319960-2319982 AGCTTAAATGTTTAAATTCTCGG + Intronic
1169435748 20:5588202-5588224 ACCTCAAAAGTTGCAAATATAGG + Intronic
1177156661 21:17507809-17507831 CCATCAAATCCTGAAATTCTTGG - Intergenic
1182412547 22:30199481-30199503 ACAGCAAATGTTGAGAATCTGGG - Intergenic
1183136828 22:35897133-35897155 ACCTCAAATGTTTTAATGGTGGG + Intronic
949309352 3:2678849-2678871 ACCTCATCTGTTGACTTTCTAGG - Intronic
949914739 3:8950706-8950728 ACCAGAAATGTTGAAATTATCGG + Intronic
950498392 3:13348154-13348176 TCCTAAAATGCTGCAATTCTAGG - Intronic
950986796 3:17380359-17380381 ACCTAAAATTTTGAGATTTTTGG + Intronic
951356420 3:21672392-21672414 AACTCAAATGTTGAAACTCAAGG + Intronic
951402721 3:22253654-22253676 ACCACAAATGATGTTATTCTGGG + Intronic
952239616 3:31516934-31516956 ACATGAGATGTTGAAATTGTTGG + Intergenic
953460061 3:43074861-43074883 ACCTCAAAAGTTTACATCCTGGG - Intergenic
954977237 3:54707732-54707754 ACCCCACATAGTGAAATTCTTGG - Intronic
955016155 3:55071912-55071934 GCCTCAAAGGTGGAAATTGTTGG + Intronic
955905108 3:63799018-63799040 ACCTAAAATGTTGACATTATAGG - Intergenic
955912846 3:63875390-63875412 AATTCACATGTTGAAATCCTAGG - Intronic
956624610 3:71254888-71254910 ATTTCAAATGTTGCAATGCTGGG - Intronic
957129923 3:76209986-76210008 AACTCAAGTGATGAAGTTCTGGG - Intronic
958179222 3:90036122-90036144 GCTCCAAATGTTGAAATTTTTGG - Intergenic
958539698 3:95455093-95455115 ACCTGAGATTTTGAAATTCAAGG - Intergenic
959643480 3:108668871-108668893 CTCTAATATGTTGAAATTCTTGG - Intronic
960094230 3:113672852-113672874 ATCTCAAATATTGAAATTACAGG - Intronic
961102606 3:124214340-124214362 ACCTCAAATGTTCAACCTCAGGG - Intronic
962263238 3:133927977-133927999 ACCTGAGCTGTTGAAACTCTGGG + Intergenic
962926249 3:139995865-139995887 AGGTCAAATTTTAAAATTCTAGG - Intronic
963190401 3:142464654-142464676 ACCTCAAATGGTTAAATTAATGG + Intronic
963497961 3:146092786-146092808 CCCTAACATGTTCAAATTCTAGG - Intronic
963871992 3:150426872-150426894 ACCTCTAATTTTAAAATTATTGG + Intronic
964507216 3:157412479-157412501 ACCTCAGAGGTTGAATTTTTTGG + Intronic
964590295 3:158354468-158354490 ACCTCAAATATTGAACTTAAAGG + Intronic
967049667 3:185771007-185771029 ACCCAAAATGCTGAAATTATAGG + Intronic
968380369 4:90209-90231 TCCTAAAATGTTGAAATTACAGG + Intergenic
969141172 4:5074319-5074341 ATCTCAAATTTTAAAATTCATGG - Intronic
970517434 4:16847063-16847085 ACCTCAACTATTCAAATTTTGGG - Intronic
971138214 4:23893652-23893674 ACTTAAAATGTTGAAGCTCTTGG - Intronic
973254941 4:48100668-48100690 TCCTCAAAGGTGCAAATTCTGGG - Intronic
974324722 4:60398709-60398731 ACCTCAAATGTTGTAGTTGGAGG + Intergenic
975135610 4:70871353-70871375 TCCTCAATTTTTAAAATTCTAGG - Intergenic
976026526 4:80694225-80694247 ACCTCAAAGGGTGAAATGCAGGG - Intronic
976542330 4:86293195-86293217 ACCTCAAAGTTTGAAATTCTAGG - Intronic
977486580 4:97655305-97655327 ACCTCTAATATAGAAAGTCTAGG - Intronic
977873735 4:102124740-102124762 AGTTTAAATGTTGAAATCCTGGG - Intergenic
978117978 4:105044863-105044885 ACCTCACATTTTGAAATTATAGG - Intergenic
979306390 4:119149337-119149359 GCCTCACAGGGTGAAATTCTGGG + Intronic
981340467 4:143616210-143616232 AACTCCAGTCTTGAAATTCTAGG - Intronic
981997528 4:150990759-150990781 ACCTAAAATGCTGATATTATAGG - Intronic
983386239 4:167065887-167065909 CCCTCAATTGGAGAAATTCTGGG + Intronic
984124856 4:175795489-175795511 ACCGAAAATGTTGAGATTATAGG - Intronic
985011877 4:185591250-185591272 GCCTCTAATGTTGAAATTTCAGG - Intronic
986453688 5:7893173-7893195 ACCTTTTATGTTGATATTCTTGG + Intronic
987532564 5:19141400-19141422 ACCTCAAATGGCTTAATTCTAGG - Intergenic
987604886 5:20120832-20120854 AACTTAAATGTTGAAATCCAAGG - Intronic
987612121 5:20219167-20219189 ACCAATAATGTTGAAATTCAAGG + Intronic
988515054 5:31897210-31897232 AACTCAAATCTTGAAATTTAGGG + Intronic
988793702 5:34633035-34633057 ACCCCAGATATGGAAATTCTGGG - Intergenic
990252147 5:53926895-53926917 ACCTCACATGTTGAACTATTTGG + Intronic
990318030 5:54602381-54602403 CCTGCAAATGTTGAGATTCTAGG + Intergenic
990562660 5:56998354-56998376 ACCTAAAATGTTGAGATTATAGG + Intergenic
992938828 5:81741268-81741290 ACCTCGAATAGTCAAATTCTTGG + Intronic
993617489 5:90131506-90131528 ACCTCAGATGATGAGATTCCTGG + Intergenic
993814304 5:92522359-92522381 ACCTGAAAAGTTGAAATCATTGG + Intergenic
997328411 5:133041379-133041401 AACTCACATCTTGAACTTCTGGG - Intergenic
998573370 5:143286096-143286118 CCTTCAAATGTTGAATTTATTGG - Intronic
999847421 5:155499772-155499794 AGCTCAAGATTTGAAATTCTGGG - Intergenic
1000077166 5:157801772-157801794 ACCTACTATGTTAAAATTCTTGG - Intronic
1000875878 5:166637841-166637863 ACATCTGATTTTGAAATTCTGGG - Intergenic
1004581605 6:16959504-16959526 GCCTTTAATGTTGAAATTATGGG - Intergenic
1005567653 6:27112983-27113005 ATCTCAAATGTAGAAATCATAGG - Intergenic
1008017342 6:46535662-46535684 ACCTAAAACTATGAAATTCTTGG - Intergenic
1008497670 6:52149602-52149624 ACCCCAAATGCTGAGATTTTAGG - Intergenic
1008749831 6:54719197-54719219 ACCTCAAATATTCAATTTATAGG + Intergenic
1008754043 6:54772360-54772382 AACTCAAAAGTTGAGATTTTGGG + Intergenic
1008893321 6:56521942-56521964 ACATAAAATGTTGATAATCTTGG + Intronic
1009349436 6:62655546-62655568 ACCTCAAATGTTTAAAGTTCTGG - Intergenic
1012430775 6:99161549-99161571 GCCTCAAAAGTAGATATTCTAGG - Intergenic
1012663212 6:101931079-101931101 ACATTAAATGTTGATATTTTTGG + Intronic
1012862972 6:104583218-104583240 CACTGAAAGGTTGAAATTCTAGG - Intergenic
1013997268 6:116323083-116323105 ACTTCAATTGTTGCAAATCTGGG - Intronic
1015073112 6:129121611-129121633 ACCTCAAATCTGGAAATTGTAGG + Intronic
1017059192 6:150465436-150465458 ACCTAAAATGTCAAAATTCCTGG + Intergenic
1017338210 6:153287074-153287096 AATTCATATGTTGAAATCCTGGG + Intergenic
1018039889 6:159912276-159912298 TCTTCTAATGGTGAAATTCTAGG - Exonic
1018514503 6:164563574-164563596 AATTCAAATTTTCAAATTCTGGG + Intergenic
1018550333 6:164990557-164990579 AACACAGATGTTGAAATTATCGG - Intergenic
1020655456 7:10923540-10923562 ACATCAGATGTTGAATTTATGGG - Intergenic
1021126589 7:16857837-16857859 TCATCAAATGTTGAAATTACAGG + Intergenic
1021515524 7:21480662-21480684 ATGTCAAATATTGAGATTCTTGG - Intronic
1021803265 7:24329384-24329406 AGCTTAAATGTGGAAATGCTGGG - Intergenic
1024742965 7:52374970-52374992 ATTTCAAAAGTTGAAATTCTAGG - Intergenic
1027419933 7:78008945-78008967 TCCTCAAATCTTAAACTTCTTGG + Intergenic
1028166566 7:87544679-87544701 TTCTAAAATGTTGACATTCTGGG + Intronic
1028195243 7:87899110-87899132 ACCTAAAATGGTAAAACTCTTGG + Intronic
1029050732 7:97683982-97684004 TCCTCAAATGTTGGAATTATAGG - Intergenic
1029255886 7:99269182-99269204 ACATGAAAGGTTGACATTCTGGG - Intergenic
1030553093 7:110989276-110989298 TCCTAAAATGTTGAGATTATAGG - Intronic
1030589948 7:111468474-111468496 ATTTCAAATGATGAAATTTTAGG - Intronic
1031154216 7:118089751-118089773 AATTCAAAAGTTGAATTTCTAGG + Intergenic
1033926874 7:146473054-146473076 ATCTCAAATGTTGAAAATTCAGG - Intronic
1035016396 7:155770134-155770156 AGCCCAAACGTTGAAATTCAGGG + Intronic
1035099467 7:156384423-156384445 CCCTCAAAAGTTGAAGCTCTGGG + Intergenic
1036225403 8:6953768-6953790 TCCTCAAATGGTGAAATTCCTGG - Intergenic
1039838027 8:41272729-41272751 TTCTCAGATGTTGAAACTCTTGG - Intronic
1040920230 8:52607890-52607912 AACTCAATTTTTGAAATTCTAGG + Intergenic
1042884993 8:73539304-73539326 ATCTCTGATGTTGAAATTATGGG + Intronic
1043224224 8:77702080-77702102 ACCTTAAATTTAGAATTTCTGGG - Intergenic
1045410235 8:101909980-101910002 ACTCCCAATGGTGAAATTCTAGG - Intronic
1051855166 9:21557291-21557313 TCCTCAAATGTTAATAATCTGGG + Intergenic
1052027060 9:23585228-23585250 ACTTCAAACCTTGAAACTCTTGG + Intergenic
1052298362 9:26924689-26924711 AATTCAAATGTTGAAATTTCTGG - Intronic
1055896587 9:81183903-81183925 TCCACAAATGTTTAAATTCCTGG - Intergenic
1056055910 9:82823884-82823906 ACCTCCAAGGTAGATATTCTTGG + Intergenic
1056947486 9:91011791-91011813 TCCCCAAATGTTAAAATTCTGGG - Intergenic
1058646047 9:107132379-107132401 TCCTCAGAGGTTGACATTCTAGG + Intergenic
1060904600 9:127293644-127293666 ACTTCACATATTGGAATTCTCGG - Intronic
1186381361 X:9063604-9063626 AACCCAAATGTTGAAATTGTAGG + Intronic
1186709020 X:12173452-12173474 AGCTTAAATGTTCAAATTCAAGG + Intronic
1187421910 X:19142566-19142588 AGCTAAAATGATGAAACTCTTGG + Intergenic
1188863990 X:35291911-35291933 ACCTCAAATGTTACTATCCTTGG + Intergenic
1189452175 X:41146470-41146492 AACTCAAATGTTTAAAAACTAGG - Intronic
1189534284 X:41921685-41921707 GCCTCACATGGTGAAATTGTGGG - Intronic
1189747024 X:44179704-44179726 ACCTGACTTGCTGAAATTCTGGG - Intronic
1191738450 X:64412007-64412029 ACCTCAAACTTTGAAATCCCTGG - Intergenic
1194382222 X:93208335-93208357 ACCTCAAACTTTGAAACTCCTGG + Intergenic
1196798017 X:119517936-119517958 ACTTCAATTGTAGAAATTTTAGG + Intergenic
1199775132 X:151004081-151004103 TCCTCAAATGCTGGAATTATAGG + Intergenic
1200621343 Y:5453411-5453433 ACCTCAAATTATAAAAATCTTGG + Intronic