ID: 1157303674

View in Genome Browser
Species Human (GRCh38)
Location 18:46500131-46500153
Sequence CCTCAAATGTTGAAATTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 9, 3: 37, 4: 417}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157303662_1157303674 28 Left 1157303662 18:46500080-46500102 CCCCTTCTCTTTTCTTCTTCCCC 0: 1
1: 3
2: 27
3: 279
4: 2540
Right 1157303674 18:46500131-46500153 CCTCAAATGTTGAAATTCTTGGG 0: 1
1: 0
2: 9
3: 37
4: 417
1157303670_1157303674 -3 Left 1157303670 18:46500111-46500133 CCTTCTTTTCCATTATCTCACCT 0: 1
1: 0
2: 5
3: 59
4: 561
Right 1157303674 18:46500131-46500153 CCTCAAATGTTGAAATTCTTGGG 0: 1
1: 0
2: 9
3: 37
4: 417
1157303663_1157303674 27 Left 1157303663 18:46500081-46500103 CCCTTCTCTTTTCTTCTTCCCCC 0: 1
1: 3
2: 32
3: 298
4: 2461
Right 1157303674 18:46500131-46500153 CCTCAAATGTTGAAATTCTTGGG 0: 1
1: 0
2: 9
3: 37
4: 417
1157303669_1157303674 3 Left 1157303669 18:46500105-46500127 CCTCTTCCTTCTTTTCCATTATC 0: 1
1: 1
2: 8
3: 91
4: 1062
Right 1157303674 18:46500131-46500153 CCTCAAATGTTGAAATTCTTGGG 0: 1
1: 0
2: 9
3: 37
4: 417
1157303668_1157303674 6 Left 1157303668 18:46500102-46500124 CCTCCTCTTCCTTCTTTTCCATT 0: 1
1: 2
2: 28
3: 339
4: 2871
Right 1157303674 18:46500131-46500153 CCTCAAATGTTGAAATTCTTGGG 0: 1
1: 0
2: 9
3: 37
4: 417
1157303664_1157303674 26 Left 1157303664 18:46500082-46500104 CCTTCTCTTTTCTTCTTCCCCCT 0: 1
1: 5
2: 27
3: 298
4: 2639
Right 1157303674 18:46500131-46500153 CCTCAAATGTTGAAATTCTTGGG 0: 1
1: 0
2: 9
3: 37
4: 417
1157303666_1157303674 8 Left 1157303666 18:46500100-46500122 CCCCTCCTCTTCCTTCTTTTCCA 0: 1
1: 2
2: 42
3: 439
4: 3091
Right 1157303674 18:46500131-46500153 CCTCAAATGTTGAAATTCTTGGG 0: 1
1: 0
2: 9
3: 37
4: 417
1157303665_1157303674 9 Left 1157303665 18:46500099-46500121 CCCCCTCCTCTTCCTTCTTTTCC 0: 2
1: 49
2: 450
3: 3259
4: 12695
Right 1157303674 18:46500131-46500153 CCTCAAATGTTGAAATTCTTGGG 0: 1
1: 0
2: 9
3: 37
4: 417
1157303667_1157303674 7 Left 1157303667 18:46500101-46500123 CCCTCCTCTTCCTTCTTTTCCAT 0: 1
1: 2
2: 42
3: 409
4: 2934
Right 1157303674 18:46500131-46500153 CCTCAAATGTTGAAATTCTTGGG 0: 1
1: 0
2: 9
3: 37
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157303674 Original CRISPR CCTCAAATGTTGAAATTCTT GGG Intronic
901208429 1:7510640-7510662 TTTCAAGTGATGAAATTCTTGGG + Intronic
905464752 1:38144477-38144499 ACTCCAATGTTAATATTCTTTGG - Intergenic
907172696 1:52484419-52484441 CCTCAAATTTTGGTATCCTTGGG + Intronic
908589749 1:65617561-65617583 CCTCAAATGTAGAAATCCGCTGG + Intronic
908810246 1:67974926-67974948 CCTCACATGCTGGAATTCTGGGG + Intergenic
909046184 1:70712683-70712705 ACTCAAATGTTAATATTCTTTGG + Intergenic
911264387 1:95726124-95726146 CTTCAAATCTTGAGAGTCTTCGG - Intergenic
911289070 1:96033690-96033712 CTTCATATGTAGAAACTCTTTGG + Intergenic
911387953 1:97201195-97201217 CCTTAAATGTTAAAAATCTGTGG - Intronic
911561832 1:99416060-99416082 TCTTAAATGTTGATATTCTGTGG - Intergenic
911889676 1:103352124-103352146 ACTCAAATGTTAACCTTCTTTGG + Intergenic
913311652 1:117502801-117502823 CTTCAAAACTTGAAATTCTACGG + Intronic
917038052 1:170771060-170771082 CCTCAAATGTTAATCTCCTTTGG + Intergenic
917057466 1:170998872-170998894 CCTCAAAGTTTGAAAGTATTGGG - Intronic
919230468 1:194766176-194766198 GCTCAAATGTTAAACTCCTTTGG + Intergenic
920689348 1:208134120-208134142 CCTCTTATTTTGAAATCCTTTGG - Intronic
920713422 1:208317007-208317029 ACACAAATATTTAAATTCTTAGG - Intergenic
920816388 1:209337146-209337168 TTTCAAAAGTTGAAATTATTTGG - Intergenic
922441627 1:225659988-225660010 CTTCAAATGTTCATTTTCTTGGG + Intergenic
923663123 1:235976127-235976149 CCTCGAATCTTGTGATTCTTGGG + Exonic
923957551 1:239040125-239040147 ACTCAAATGTTGATTTCCTTTGG - Intergenic
924265986 1:242282805-242282827 CCTAAAATGTTGAAATTCCTGGG - Intronic
924638540 1:245811444-245811466 TTTGAAATGTTGAAAGTCTTGGG + Intronic
1063358299 10:5423568-5423590 CCTTAAATGTTGTAATTATTTGG + Intronic
1064517274 10:16165319-16165341 ACTCAAATGTTAATATCCTTTGG + Intergenic
1064734531 10:18367235-18367257 GCACAAATGTTGAAATACTTTGG + Intronic
1064883212 10:20080691-20080713 ACTCAAATGTTAATCTTCTTTGG + Intronic
1065058362 10:21871209-21871231 CATGAAATGTTGACATTCCTGGG + Intronic
1065191982 10:23220854-23220876 CATCAAAGGTTGAACTTCTTAGG - Intronic
1065436814 10:25711279-25711301 CCTCAAATGGTGACCTTATTTGG - Intergenic
1065868017 10:29930395-29930417 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1066036693 10:31495955-31495977 CCTTAAATGTTTAAGTACTTAGG + Intronic
1066718848 10:38315732-38315754 CCTAAAATGTTGAAATTCCTGGG + Intergenic
1067125180 10:43509775-43509797 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1067860029 10:49836685-49836707 GCTCAGATGCTGAACTTCTTAGG + Intronic
1068156376 10:53205136-53205158 CCTCAAATGGTAATATCCTTTGG - Intergenic
1068402171 10:56542723-56542745 CTTCAATTGTTGAACTACTTTGG - Intergenic
1069244736 10:66190022-66190044 CTTCAAATTTGGAAAGTCTTTGG - Intronic
1071166304 10:82811453-82811475 CCTGCAATGGTGAAATTCTGGGG + Intronic
1071179986 10:82972379-82972401 CCAGCCATGTTGAAATTCTTTGG + Intronic
1071181342 10:82987439-82987461 TCTCAGATGTTGAAACACTTTGG + Intergenic
1071262418 10:83932843-83932865 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1071458564 10:85870084-85870106 ACTCAAATGTTAAAATCCTTTGG - Intronic
1071666348 10:87562547-87562569 TCTCAGATTTGGAAATTCTTGGG + Intergenic
1071805958 10:89121169-89121191 CCTCAACTTTTGAAAGACTTTGG + Intergenic
1072124158 10:92430773-92430795 CATTAAATGTTGAACTTCATTGG - Intergenic
1073228361 10:101944380-101944402 CATCAAATGTGGAAATGTTTTGG - Intronic
1073495398 10:103886260-103886282 CATCAAATGTTAATTTTCTTCGG + Intronic
1073855027 10:107663833-107663855 ACTCAAATGTTAATATCCTTTGG - Intergenic
1074244468 10:111675149-111675171 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1074666410 10:115731093-115731115 ACTCAAATGTTAATCTTCTTTGG + Intronic
1075223282 10:120602656-120602678 ACTCAAATGTTAAACTCCTTTGG - Intergenic
1077668177 11:4134310-4134332 CCCCAAATTTTGATATACTTTGG - Intronic
1078421676 11:11217753-11217775 ACTCAAATGTTGATATCCTTTGG + Intergenic
1078693526 11:13606021-13606043 CCTCAAATTATGAAACTCTGGGG - Intergenic
1079532345 11:21469448-21469470 CCTGAAATTATGAAATTCTAAGG - Intronic
1080186307 11:29491312-29491334 ACTCAAATGTTAATATCCTTTGG - Intergenic
1081239616 11:40688496-40688518 CATCAAATGTTGAAAGCCTTGGG + Intronic
1081363850 11:42211892-42211914 CTTGGATTGTTGAAATTCTTTGG - Intergenic
1084722309 11:70914813-70914835 CCTCAAATTCTCAAATTCCTAGG - Intronic
1085103217 11:73819537-73819559 GCCCAAAGTTTGAAATTCTTAGG - Intronic
1085685479 11:78618566-78618588 ACTCAAATGTTAATATCCTTTGG - Intergenic
1086145496 11:83546744-83546766 CATCAAATCATGAAATCCTTAGG - Intronic
1087129801 11:94658810-94658832 AACCAAATATTGAAATTCTTGGG + Intergenic
1087483144 11:98727092-98727114 ACTCAAATGTTGATCTCCTTTGG + Intergenic
1088755142 11:112879232-112879254 CCTCAGAAGGTGAACTTCTTTGG + Intergenic
1089234615 11:117012804-117012826 CATAATATATTGAAATTCTTAGG + Intronic
1089940858 11:122415861-122415883 CCTAAAATGTTGATATGCCTTGG + Intergenic
1090577602 11:128124208-128124230 ACTCAAATGTTAAACTCCTTTGG + Intergenic
1090977511 11:131689933-131689955 CCACATATGATGAAATTCTATGG + Intronic
1091443814 12:531749-531771 CCTCAAACTTGGAAATTTTTAGG + Intronic
1091657755 12:2358057-2358079 CCTCAAATGGTGAACATGTTGGG - Intronic
1092947554 12:13471201-13471223 ACTCAAATGTTGAAATGCACAGG + Intergenic
1093545957 12:20348324-20348346 CCTCAAATGATAAGATTCATAGG + Intergenic
1093562470 12:20558611-20558633 CCTGAAATTTCCAAATTCTTTGG - Intronic
1093950608 12:25162079-25162101 CCTTGAATGTTAAAATCCTTTGG - Intronic
1094765203 12:33586665-33586687 CTTGAAATGGTGAAATTCTAAGG - Intergenic
1096221660 12:49833242-49833264 CCTCTAATGTTGATGTTCCTTGG - Intergenic
1096690572 12:53318825-53318847 CCTTAAATGTTGGTGTTCTTGGG - Intronic
1097366698 12:58722568-58722590 ACTCAAATGTTAATATCCTTTGG + Intronic
1098221590 12:68275484-68275506 CCTTAAATGTTGGCATTCCTTGG - Intronic
1098544373 12:71695016-71695038 CCTCAAGTCTTCAAATTATTTGG + Intronic
1098733915 12:74072562-74072584 CCTCATATGATTAAATCCTTAGG + Intergenic
1098858733 12:75683675-75683697 CCTGCAATGTTTAAATTCTTTGG + Intergenic
1099291539 12:80782317-80782339 ACTCAAATGTTAATTTTCTTTGG - Intergenic
1099993283 12:89750168-89750190 ACTCACATTTTGAAATTCTGTGG + Intergenic
1100266555 12:92982233-92982255 ACTCAAATGTTAAACTCCTTTGG - Intergenic
1100990229 12:100243910-100243932 CCTAAAATGTTATATTTCTTTGG + Intronic
1106015629 13:25866470-25866492 TATAAAATGTTCAAATTCTTTGG - Intronic
1106743828 13:32678237-32678259 CCTAAAAAGTTAAAATTCTTTGG - Intronic
1107066849 13:36223003-36223025 CATCAAATGTGGAAAATTTTGGG - Intronic
1107381491 13:39861443-39861465 TCTTAAATGTTGAAATTCGTTGG - Intergenic
1107424877 13:40282879-40282901 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1107573956 13:41697171-41697193 CCCCAAATATTGGAATTGTTTGG + Intronic
1108146434 13:47482335-47482357 TCTCAAATGTTAACATTCATGGG - Intergenic
1108370844 13:49766385-49766407 CCTCTATTGCTGAATTTCTTAGG + Intronic
1108465525 13:50711541-50711563 TCTCAGATGCTGAAATACTTTGG + Intronic
1108904580 13:55452437-55452459 ACTCAAATGCTAAATTTCTTTGG - Intergenic
1108963225 13:56263362-56263384 ACTCAAATATTGAAATTATCAGG - Intergenic
1109166909 13:59046982-59047004 CCCCAAATGTCAAAATGCTTAGG - Intergenic
1109799941 13:67363287-67363309 ACTCAAATGTTAATATCCTTTGG + Intergenic
1110750564 13:79110262-79110284 ACTCAAATGTTGATCTCCTTTGG - Intergenic
1110958467 13:81588041-81588063 TCTCAAATTTTAATATTCTTAGG - Intergenic
1111261779 13:85749787-85749809 ACTCAAATGTTGATCTCCTTTGG + Intergenic
1111509264 13:89239774-89239796 ACTCAAACATGGAAATTCTTGGG - Intergenic
1111524968 13:89456620-89456642 ACTCAAATGTTGATCTCCTTTGG - Intergenic
1111675343 13:91380387-91380409 CTTTAAATGTTAAAATTATTTGG + Intergenic
1111818223 13:93181895-93181917 CATCAAATAGTGAAATTCTTAGG - Intergenic
1111977520 13:94982572-94982594 ACTCAAATGTTGATCTCCTTTGG - Intergenic
1112968423 13:105228372-105228394 CCTCTATTGTTGACATTCTAAGG + Intergenic
1113218713 13:108073082-108073104 ACTCAATTGTTAATATTCTTTGG + Intergenic
1113289309 13:108887202-108887224 CCTCATTTGTTGATACTCTTAGG + Intronic
1114205450 14:20567398-20567420 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1114594052 14:23896030-23896052 GCTCAATTGGTGAAATTCTTAGG - Intergenic
1115933450 14:38524911-38524933 CCTCCAACCTTGAAAATCTTAGG - Intergenic
1115950006 14:38710292-38710314 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1116166796 14:41343732-41343754 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1116541834 14:46109550-46109572 CCTCAACAGTTGCAATTCCTGGG + Intergenic
1116635540 14:47390071-47390093 CCTCAAATGCTGAAGTTCTACGG - Intronic
1117222114 14:53616753-53616775 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1118018664 14:61688260-61688282 ACTAAAATATTGAAATACTTAGG - Intergenic
1118122129 14:62857764-62857786 ACTCAAATGTTAAACTCCTTTGG + Intronic
1120517431 14:85487618-85487640 CCACAATGGTTGAGATTCTTGGG - Intergenic
1120555719 14:85928171-85928193 ACTCAAATGTTAATATCCTTTGG + Intergenic
1120669960 14:87352047-87352069 CCTCAAATGTTTAATCTCTAAGG + Intergenic
1122828029 14:104381146-104381168 CCTCATATGTTGAGTTACTTTGG - Intergenic
1123184575 14:106504694-106504716 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1123967130 15:25470119-25470141 CCTCTTATTTTAAAATTCTTTGG - Intergenic
1126318517 15:47396710-47396732 ACTCAAATGTTAATCTTCTTTGG + Intronic
1126454420 15:48845668-48845690 CCTCAAATGTTCAAATTATCAGG + Intronic
1127787865 15:62371993-62372015 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1131659001 15:94493730-94493752 ACTCAAATGTTAAACTCCTTTGG - Intergenic
1132220567 15:100102280-100102302 CCTCAAATGTAGATCTCCTTCGG - Intronic
1134683478 16:16142641-16142663 TCTCAAAACTTGAACTTCTTGGG + Exonic
1135003619 16:18799664-18799686 ACTCAGATGTTGACATTCATTGG + Intronic
1135924722 16:26683248-26683270 ACTCAAATGTTGATCTCCTTTGG + Intergenic
1140660129 16:77181674-77181696 CCACAAATTTTGAAATGTTTTGG - Intergenic
1150167203 17:62955416-62955438 CCTCAAATGTTAATCTCCTTTGG - Intergenic
1151049677 17:70963168-70963190 CATCAAAAGTTGAAAATGTTAGG - Intergenic
1153115448 18:1649522-1649544 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1153131610 18:1860240-1860262 CCTCAAATGTGGAAAGGCTGAGG + Intergenic
1153175168 18:2363771-2363793 CCTCAAATGTTAATCTCCTTTGG - Intergenic
1153774517 18:8440940-8440962 CCTCATCTGTTGATATTGTTTGG - Intergenic
1153902489 18:9630288-9630310 ACTCAGTTTTTGAAATTCTTAGG - Intergenic
1155686813 18:28563408-28563430 ACTCAAATGTTAAACTCCTTTGG + Intergenic
1156133602 18:34008159-34008181 CCTCAGATGTTGGCACTCTTGGG + Intronic
1156272568 18:35549978-35550000 CCTAAAATGTTGAATTTATTTGG - Intergenic
1156990749 18:43404481-43404503 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1157011618 18:43655800-43655822 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1157303674 18:46500131-46500153 CCTCAAATGTTGAAATTCTTGGG + Intronic
1157786560 18:50488825-50488847 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1157855027 18:51097700-51097722 CCTCGAATGATGAAATTAGTAGG + Intergenic
1157948744 18:52010772-52010794 CTCCAAATGCTAAAATTCTTAGG + Intergenic
1158274518 18:55752362-55752384 ATTCAAATTTTGTAATTCTTGGG + Intergenic
1158335302 18:56409930-56409952 CCTCACATGTTGAAACCTTTTGG - Intergenic
1158351276 18:56567004-56567026 CCTAAAATGCTGATTTTCTTGGG - Intergenic
1158534224 18:58292799-58292821 TCTGAAATGTTGATATTCTGTGG + Intronic
1159001248 18:62977378-62977400 CTTCAAATTTTGAGATTCTCAGG - Intronic
1159287191 18:66369747-66369769 CCTGAAAAGTCTAAATTCTTAGG + Intergenic
1159559532 18:69978718-69978740 ACTCAAATGTTGATCTCCTTTGG + Intergenic
1159861155 18:73651292-73651314 CTTTAACTGATGAAATTCTTGGG - Intergenic
1160054177 18:75464088-75464110 ACTCAAAATTTGACATTCTTTGG + Intergenic
1160279309 18:77472471-77472493 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1161780408 19:6287915-6287937 CCTCAAGTGTTGAGAATGTTGGG + Intergenic
1164666159 19:30039169-30039191 CATCAAATGTGGAAATATTTTGG + Intergenic
1165146045 19:33731073-33731095 ACTCAAATGTTAAAGTCCTTTGG + Intronic
1165327555 19:35123116-35123138 CCCCAAATCCTGAAATGCTTTGG + Intronic
1165949754 19:39467652-39467674 CCTGGGATGTTGAAATTCCTGGG - Intronic
1166403120 19:42498699-42498721 CCTCAATTCCTGAAATTCTCTGG - Intergenic
925517178 2:4695822-4695844 CCAAACATGTTGAAATGCTTTGG - Intergenic
925873882 2:8295309-8295331 AATCAATTGTTGAAATTGTTCGG + Intergenic
926647206 2:15302739-15302761 ACTCAAATGTTAACCTTCTTTGG - Intronic
926810856 2:16754310-16754332 ACTCAAATGTTAATATCCTTTGG + Intergenic
926832772 2:16981529-16981551 ACTCAAATGTTAATATCCTTTGG - Intergenic
926987211 2:18638302-18638324 ACTCAAATGTTAATCTTCTTTGG - Intergenic
927009022 2:18882148-18882170 ACTCAAATGTTAAACTCCTTTGG - Intergenic
927085801 2:19673061-19673083 ACTCAGATGGTGACATTCTTAGG - Intergenic
927427037 2:22992926-22992948 CAACAGATGTTGAAACTCTTGGG - Intergenic
927643915 2:24863191-24863213 ACTCAAATGTTAAACTCCTTTGG - Intronic
928315559 2:30242032-30242054 ATTCAATTGTTGAAATTTTTAGG + Intronic
928713194 2:34030579-34030601 CCTCAAATCTTTGAGTTCTTTGG - Intergenic
928845742 2:35669602-35669624 ACTCAAATGTTAATCTTCTTTGG + Intergenic
929081001 2:38122181-38122203 TTTCAGATGTTGAAAATCTTCGG + Intergenic
929425951 2:41844968-41844990 ACTCAAATGTTCATCTTCTTTGG - Intergenic
930452115 2:51555122-51555144 CATCAAGAGTTGATATTCTTTGG - Intergenic
931016714 2:57990172-57990194 TCTCACATGTTGAGAGTCTTTGG - Intronic
931596599 2:63952299-63952321 ACTTAAGTTTTGAAATTCTTTGG - Intronic
933352800 2:81177191-81177213 CCTCATATGGTTAAAATCTTTGG + Intergenic
933425866 2:82111794-82111816 CCTCAAATGTGTAATTTCTGAGG + Intergenic
933484344 2:82898430-82898452 ACTCAAATGTTAATATCCTTTGG + Intergenic
933712533 2:85337586-85337608 ACACAAATTTTGCAATTCTTTGG - Intergenic
934072832 2:88401101-88401123 CCTCAAATATTAAGCTTCTTTGG - Intergenic
934982535 2:98856070-98856092 CCTCAAATTTAGAAAGTTTTTGG - Intronic
935444071 2:103137837-103137859 ACTCAAATGTTAATCTTCTTTGG - Intergenic
935700000 2:105803212-105803234 CATCAAATTTTTAAATTCTAAGG + Intronic
935811408 2:106801034-106801056 CCTCAAATCAAGAAAGTCTTTGG - Intergenic
936372426 2:111913370-111913392 CTCCAAATGGTGAAATACTTAGG - Intronic
936558996 2:113520277-113520299 ACTCAAATGTTAAAATTCTTAGG + Intergenic
937267368 2:120625011-120625033 CCCCAAATTTTCTAATTCTTCGG - Intergenic
937771474 2:125725335-125725357 CCTCAAATCTTAGAATTCATAGG + Intergenic
938151406 2:128888393-128888415 ACTCAAATGTTAATATCCTTTGG - Intergenic
938234466 2:129693607-129693629 GATCAAATGTTTAAATTTTTAGG + Intergenic
938861860 2:135377829-135377851 ACTCAAATGTTAATATCCTTTGG - Intronic
938997208 2:136692763-136692785 ACTCAAATGTTAAACTCCTTTGG + Intergenic
939385131 2:141486200-141486222 CCTCATATGTTGATATAATTTGG - Intronic
940408990 2:153337832-153337854 CCTCAAATATGGATGTTCTTTGG + Intergenic
940653025 2:156456301-156456323 CTTCAAATGTTGGTCTTCTTGGG + Intronic
943158903 2:184220821-184220843 CTTGAAAGGTTGAAATTCTCAGG - Intergenic
943967057 2:194350475-194350497 ACTCAAATGTTGATGTCCTTTGG - Intergenic
944336449 2:198540868-198540890 ACTCAAATGTTAATCTTCTTTGG - Intronic
945377820 2:209099657-209099679 ACTCAAATGTTAATATCCTTTGG + Intergenic
945675798 2:212854189-212854211 TCTGAAATGTTGAAAATGTTGGG + Intergenic
945773551 2:214077041-214077063 CCTTAAATGTTGTTATTCTTAGG - Intronic
946348293 2:219129089-219129111 CCTCAAATATTGTTCTTCTTGGG - Intronic
946790451 2:223296006-223296028 ACTCAAATGTTAAACTCCTTTGG - Intergenic
947159666 2:227199667-227199689 TCTTAAATATTGAGATTCTTGGG + Intronic
947862262 2:233368988-233369010 CCTGAAATCTTGAAACTCCTAGG - Intronic
948917548 2:241043139-241043161 CATCAAATGTGGAAAATGTTTGG - Intronic
1169019657 20:2319961-2319983 GCTTAAATGTTTAAATTCTCGGG + Intronic
1169291549 20:4357598-4357620 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1169582979 20:7046296-7046318 CTTCGAATTTTGAAATTCTCAGG - Intergenic
1170351168 20:15442986-15443008 CCTCAATTGTTTACATTTTTTGG + Intronic
1172116810 20:32577942-32577964 CCCCAAATGTAGCAAATCTTAGG - Intronic
1172927445 20:38551649-38551671 GCTCAAAATCTGAAATTCTTTGG - Intronic
1173037036 20:39422175-39422197 CCTCAAAGTTTGAAAATCCTAGG - Intergenic
1173382403 20:42557818-42557840 GCTCCAATGTTGAAATTCTCAGG + Intronic
1173395120 20:42672154-42672176 ACTCAAATGTTAATCTTCTTTGG - Intronic
1173989608 20:47291574-47291596 AGTGGAATGTTGAAATTCTTTGG - Intronic
1174103532 20:48145652-48145674 CCTCAAATGTTAATCTCCTTTGG + Intergenic
1175758152 20:61543183-61543205 ACTCAAATGTTAACCTTCTTTGG + Intronic
1175839262 20:62016320-62016342 ACTCAAATGTTAACCTTCTTTGG - Intronic
1175848508 20:62073052-62073074 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1175930354 20:62490883-62490905 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1177139502 21:17342874-17342896 CCTCAAATGTTAATCTCCTTTGG + Intergenic
1177232436 21:18340127-18340149 ACTCAAATGTTAATCTTCTTTGG - Intronic
1177296869 21:19187232-19187254 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1177719644 21:24888943-24888965 CATTAAATGTATAAATTCTTGGG - Intergenic
1178370708 21:32024959-32024981 ACTCAAATGTTAATCTTCTTTGG + Intronic
1182532557 22:30971413-30971435 ACTCAAAGCTTGAAATTCTGTGG + Intergenic
1182743831 22:32589316-32589338 CCTCCAATGATGAGATTCTGTGG - Intronic
1184934268 22:47707401-47707423 CCTCAAATGTACAAAATCTAAGG - Intergenic
949169717 3:984152-984174 ACTCAAATGTTGATATCCTTTGG + Intergenic
949412677 3:3782914-3782936 ACTCAAATGTTAATCTTCTTTGG + Intronic
949413844 3:3796016-3796038 CCTGAGATGTTGAGATTTTTAGG + Intronic
949732889 3:7134354-7134376 CCTCATATTTTGAAAATATTAGG - Intronic
949858492 3:8483962-8483984 GCTGCAATGTTGACATTCTTAGG - Intergenic
951638090 3:24802546-24802568 ACCCAAATGTTGGAATTATTAGG - Intergenic
951645085 3:24880916-24880938 CCTCATATGTAGAAGTTCTTTGG + Intergenic
952044067 3:29296400-29296422 CCTCATCTGTTGAACTTGTTTGG + Intronic
952075930 3:29697593-29697615 TTTCAGATGTTGAATTTCTTTGG + Intronic
952602392 3:35100939-35100961 TCTCTAATGTGGAAATTCTTTGG - Intergenic
953192843 3:40704799-40704821 ACTCAAATGTTAATATCCTTTGG - Intergenic
954890146 3:53919954-53919976 CATCAAATTTGGAAATTTTTTGG + Intergenic
955184164 3:56699215-56699237 ATTCATATGTTGAAACTCTTAGG + Intergenic
955905106 3:63799017-63799039 CCTAAAATGTTGACATTATAGGG - Intergenic
957694798 3:83621654-83621676 CCTCAACTGTTGAAATGCTCAGG - Intergenic
959446707 3:106449330-106449352 CTTAAAATGTTGGAATTCTATGG - Intergenic
959643479 3:108668870-108668892 TCTAATATGTTGAAATTCTTGGG - Intronic
959734437 3:109641827-109641849 CCTCATCTTTTGAAACTCTTTGG - Intergenic
959746450 3:109780849-109780871 ACTCAAATGTTAATCTTCTTTGG + Intergenic
960140108 3:114143324-114143346 CCTGAAATGTTGAGATTAGTTGG - Intronic
960635010 3:119776079-119776101 GCTCAAACATTGAAATTATTAGG + Intergenic
962776113 3:138661819-138661841 CCTCTAATGTGGGAATTCCTAGG + Intronic
963084315 3:141422459-141422481 GCTCCTATGCTGAAATTCTTTGG + Intronic
963497959 3:146092785-146092807 CCTAACATGTTCAAATTCTAGGG - Intronic
963955677 3:151251091-151251113 CCTCAAATGTTGATGTTTTATGG + Intronic
965063537 3:163813729-163813751 CCTCATATGTTAAAGTTCTCAGG - Intergenic
965652032 3:170944236-170944258 ACTCAAATGTTAATCTTCTTTGG + Intergenic
966292801 3:178379859-178379881 CCTCAAATGATGCTATTCTCTGG - Intergenic
967745934 3:193055105-193055127 GCTCAAATGTTTAAAATGTTGGG + Intergenic
968753154 4:2400847-2400869 ACTCAAATGTTAACATCCTTTGG + Intronic
969982549 4:11173142-11173164 ACTCAAATGTTGATCTCCTTTGG - Intergenic
971687085 4:29784645-29784667 ACTCAAATGTTGATCTCCTTTGG + Intergenic
971935622 4:33143565-33143587 ACTCAAATGTTAATCTTCTTTGG + Intergenic
972084781 4:35201827-35201849 ACTCAAATGTTAATATCCTTTGG - Intergenic
972989266 4:44803575-44803597 CCTCAATTGTTGATATTCGCTGG - Intergenic
973042208 4:45483708-45483730 CCTCAGATGTTGAAAAAGTTTGG + Intergenic
973874403 4:55201864-55201886 ACTCAAATGTTGATCTCCTTTGG - Intergenic
974345803 4:60679553-60679575 ACTCAAATGTTAATCTTCTTCGG + Intergenic
974508866 4:62810952-62810974 ACTCAAATGTTAATCTTCTTTGG - Intergenic
974598683 4:64047323-64047345 ACTCAAATGTTAATATCCTTTGG - Intergenic
974680127 4:65149824-65149846 ACTCAAATGTTAATCTTCTTTGG + Intergenic
975221704 4:71820195-71820217 CCTTGAATGTTGGTATTCTTGGG + Intergenic
976542328 4:86293194-86293216 CCTCAAAGTTTGAAATTCTAGGG - Intronic
977011065 4:91633885-91633907 CCTCAAATGCCTAAATTGTTGGG + Intergenic
977871665 4:102097816-102097838 CCTCAAATGTCAATATTCTCTGG - Intergenic
978044823 4:104113494-104113516 ACTCAAATGTTAATCTTCTTTGG + Intergenic
978090072 4:104704518-104704540 CCCTAAATGTTGTATTTCTTTGG - Intergenic
978150201 4:105425659-105425681 CATCAAATTTGGAAATTTTTTGG - Intronic
978316253 4:107440742-107440764 CCTCAAACCTTGATGTTCTTTGG - Intergenic
978510245 4:109509091-109509113 ACTCAAATGTTAAAAGTCTTTGG - Intronic
979094847 4:116534667-116534689 ACTCAAATGTTAAACTCCTTTGG - Intergenic
979855935 4:125634723-125634745 CCTCAAATATACAAATACTTAGG - Intergenic
980598336 4:134986596-134986618 ACTCAAATGTTAATCTTCTTTGG - Intergenic
980957263 4:139442474-139442496 ACTCAAATGTTAAACTCCTTTGG - Intergenic
981532706 4:145767462-145767484 CCTCAAATTTGGAAAATTTTTGG - Intronic
982316287 4:154035385-154035407 TATCAAATGTTCAAATTCTCTGG + Intergenic
982527133 4:156491977-156491999 ACTCAAATGTTAATCTTCTTTGG - Intergenic
983969162 4:173849788-173849810 ACTCAAATGTTGATCTCCTTTGG + Intergenic
984079938 4:175235542-175235564 ACTCAAATGTTGATCTCCTTTGG - Intergenic
985802123 5:2011487-2011509 CATCAAATGGAGAAATTCATAGG + Intergenic
986096961 5:4567366-4567388 GCTCAAACATTAAAATTCTTAGG + Intergenic
986133795 5:4955532-4955554 ACTCAAATGTTAATCTTCTTTGG + Intergenic
986427770 5:7651648-7651670 ACTCAAATGTTAATATCCTTTGG + Intronic
986799796 5:11247092-11247114 CCTAAAATCTTGCATTTCTTGGG + Intronic
987442048 5:17968095-17968117 ACTCAAATATTAAACTTCTTTGG + Intergenic
987607795 5:20160423-20160445 ATTCAAATGTTGAAATTTTTTGG - Intronic
988329589 5:29818227-29818249 CCTAAAATGATGAATTTCTAAGG - Intergenic
989080468 5:37614466-37614488 ACTCAAATGTGGAAATCTTTGGG + Intronic
989365583 5:40652134-40652156 ACTCAAATGTTAAACTCCTTTGG + Intergenic
989989884 5:50749738-50749760 ATTAAAATGTTTAAATTCTTGGG + Intronic
990017747 5:51086025-51086047 ACTCAAATGTTAATATCCTTTGG + Intergenic
990618744 5:57536952-57536974 ACTCAAATGTTGATATCCTTTGG + Intergenic
990783351 5:59392187-59392209 ACTCAAATGTTAATCTTCTTTGG - Intronic
991033865 5:62108353-62108375 ACTCAAATGTTAATATCCTTTGG - Intergenic
991120248 5:63004615-63004637 ACTCAAATGTTAATCTTCTTTGG + Intergenic
991169531 5:63604951-63604973 CATCAAATGTAGAAAATTTTTGG + Intergenic
991197195 5:63949403-63949425 ACTTAACTGTTGAAATGCTTTGG + Intergenic
991957732 5:72012588-72012610 CCTCAAATCTTGAAATTAGGAGG - Intergenic
992319699 5:75601465-75601487 ACTCAAATGTTAATCTTCTTTGG - Intergenic
992922028 5:81535181-81535203 CCCCAAAAGATGAAATACTTAGG + Intronic
993319401 5:86454823-86454845 ACTCAAATGTTAATCTTCTTTGG - Intergenic
993413029 5:87595449-87595471 ACTCAAATGTTGATCTCCTTTGG + Intergenic
993694722 5:91047624-91047646 ACTCAAATGTTGATCTCCTTTGG + Intronic
994414145 5:99446741-99446763 CCTCAACTGTTTATATTGTTTGG - Intergenic
994686658 5:102963064-102963086 ACTCATATGTTGAAATTAGTGGG + Intronic
994761561 5:103861078-103861100 ACTCAAATGTTAAACTCCTTTGG - Intergenic
994878497 5:105455751-105455773 ACTCAAATGTTAATCTTCTTTGG + Intergenic
994941078 5:106325106-106325128 CCTCAAATGATAACATACTTAGG - Intergenic
994992805 5:107018574-107018596 CTTCATATTTTGAAAGTCTTTGG - Intergenic
995647485 5:114329302-114329324 ACTCAAATGTTAATCTTCTTTGG - Intergenic
996689348 5:126321689-126321711 CCACAAATGATGAAATACCTAGG - Intergenic
997109288 5:131057256-131057278 CCTCTAATGATGCATTTCTTAGG - Intergenic
997793256 5:136782149-136782171 ACTCAAATGTTAATCTTCTTTGG + Intergenic
999378818 5:151105605-151105627 CCTCAAATTTTTAAATGCATTGG + Intronic
999659454 5:153843779-153843801 CCACAAATCTTGGAGTTCTTCGG + Intergenic
999737970 5:154526846-154526868 TCTCAAATGTTGATATGGTTTGG + Intergenic
1000177758 5:158774552-158774574 CCTCACATCTTGAAATACTATGG + Intronic
1000189549 5:158896800-158896822 TATCAAAAGTGGAAATTCTTTGG - Intronic
1000473801 5:161679499-161679521 ACACAAATACTGAAATTCTTTGG + Intronic
1001801688 5:174549845-174549867 CATCAAATGCTGAAATGCTCAGG - Intergenic
1001887314 5:175305015-175305037 CCTCAAATGTGGGAAGTTTTTGG - Intergenic
1002938145 6:1691959-1691981 ACTCAAATGTTGATCTCCTTTGG - Intronic
1004121490 6:12826996-12827018 CCTCACTTGTTGCAATTCTGTGG + Intronic
1004452645 6:15760862-15760884 CCTCCAAGGTTGAAATACTCAGG - Intergenic
1005051698 6:21689985-21690007 CCTCACATGTTGAAATAATGAGG + Intergenic
1005595178 6:27372351-27372373 CTTCAAATGTTTAAATTCAGAGG - Intergenic
1007028707 6:38605896-38605918 ACTCAAATGTTAATCTTCTTTGG - Intronic
1007857180 6:44870063-44870085 AGAGAAATGTTGAAATTCTTTGG - Intronic
1008390672 6:50947756-50947778 ACTCAAATGTTAATATCCTTTGG + Intergenic
1008588890 6:52973843-52973865 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1008806679 6:55438013-55438035 CCTTGGATGTTGAAATTTTTAGG + Intronic
1009631073 6:66201842-66201864 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1009962281 6:70538644-70538666 TTACAAATGTTGAAATTCTTAGG - Intronic
1010024256 6:71197404-71197426 CCTGATATGTTGAAATTATATGG - Intergenic
1010323110 6:74536812-74536834 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1010323865 6:74542923-74542945 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1011053461 6:83179641-83179663 CCTCAAATGTTCAAATGACTGGG + Intronic
1012862971 6:104583217-104583239 ACTGAAAGGTTGAAATTCTAGGG - Intergenic
1014372873 6:120634415-120634437 ACTCAAATGTTAAGCTTCTTTGG + Intergenic
1014599660 6:123395018-123395040 GCTCATTTGTTGAAATTTTTGGG - Intronic
1015075612 6:129153023-129153045 CCTGACATGTTGAGTTTCTTAGG - Intronic
1015218122 6:130773561-130773583 ACTCAAATGTTGATCTCCTTTGG - Intergenic
1016512554 6:144859944-144859966 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1018039888 6:159912275-159912297 CTTCTAATGGTGAAATTCTAGGG - Exonic
1018390906 6:163341384-163341406 CCTCCAATGTTGCCATTCATGGG + Intergenic
1018534728 6:164807976-164807998 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1018579042 6:165291717-165291739 CCTTAAATGTTGATATTCTTTGG - Intronic
1020064981 7:5181445-5181467 CCTCAAATATTTATATTTTTTGG + Intergenic
1020890928 7:13876948-13876970 ACTCAAATGTTGATCTCCTTTGG - Intergenic
1021515523 7:21480661-21480683 TGTCAAATATTGAGATTCTTGGG - Intronic
1024194425 7:47045192-47045214 CATCAAATGTCCAATTTCTTGGG + Intergenic
1024486329 7:49924818-49924840 CCTCAAATCCTGAAGTCCTTGGG - Intronic
1024841645 7:53593750-53593772 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1028166567 7:87544680-87544702 TCTAAAATGTTGACATTCTGGGG + Intronic
1028204297 7:87998239-87998261 ACTCAAATGTTAATATCCTTTGG + Intronic
1029032109 7:97479425-97479447 CCTGAAATGTTTAAGTTATTGGG - Intergenic
1030707505 7:112709472-112709494 CTTCAAATCCTTAAATTCTTTGG - Intergenic
1031481835 7:122287392-122287414 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1031590218 7:123581817-123581839 CCTCAAAACTTGACAGTCTTGGG - Intronic
1032115785 7:129116086-129116108 CCTCAAATGTTGAGATGCTCTGG - Intergenic
1032139118 7:129310428-129310450 CCTCAAATGTTGATGTCCATTGG - Intronic
1032484153 7:132270750-132270772 CTTTAAATGATAAAATTCTTTGG - Intronic
1032527520 7:132590731-132590753 ACTCAAATGTTAATCTTCTTTGG + Intronic
1033429658 7:141277783-141277805 CATCAAATGTTGAGAGTCCTGGG + Intronic
1036225401 8:6953767-6953789 CCTCAAATGGTGAAATTCCTGGG - Intergenic
1036492295 8:9238893-9238915 CCAAAAATGTTTAAATTCTGAGG + Intergenic
1036982993 8:13492140-13492162 CCTCAAATGTTTTACTTTTTGGG - Intronic
1037131415 8:15411813-15411835 CCTCAAAAGGTGAAATTATTTGG + Intergenic
1038305940 8:26402178-26402200 TCTGAAATGTCGAAAATCTTTGG + Intronic
1039383897 8:37113482-37113504 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1040772936 8:51000953-51000975 CCTTAAATGGTGAATTCCTTTGG - Intergenic
1041588014 8:59544440-59544462 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1043303588 8:78765831-78765853 CCACAAATTTTCAAATTCTTTGG - Intronic
1044344655 8:91091444-91091466 ACTCAAATGTTAACCTTCTTCGG - Intergenic
1044480094 8:92675890-92675912 CAGCAAATGTTGAAATCCTTTGG + Intergenic
1046630793 8:116621425-116621447 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1047015495 8:120719157-120719179 ACTCAAATGTTAACCTTCTTTGG - Intronic
1048216364 8:132499312-132499334 CCTATAAGGTTGAAATTATTTGG + Intergenic
1048499390 8:134961896-134961918 ACTCAAATGTTAATATCCTTTGG - Intergenic
1049893855 9:95904-95926 ACTCAAATGTTAAAATTCTTAGG - Intergenic
1050286781 9:4111289-4111311 CCTCAAATATTTAACCTCTTAGG + Intronic
1050717842 9:8550109-8550131 CCTAAATTTTTCAAATTCTTGGG - Intronic
1050721889 9:8600334-8600356 CCACAAATACTGAAATTCCTAGG + Intronic
1051004903 9:12332068-12332090 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1051214567 9:14782221-14782243 CCAGAAATGTAGAAATTCCTGGG + Intronic
1051415797 9:16838586-16838608 CCTCAAATGTTTTAGTTCTGTGG + Intronic
1052213799 9:25939888-25939910 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1052298361 9:26924688-26924710 ATTCAAATGTTGAAATTTCTGGG - Intronic
1053263006 9:36687002-36687024 TCTCAAATGTTAATATCCTTTGG + Intergenic
1053735081 9:41095988-41096010 ACTCAAATGTTAAAATTCTTAGG - Intergenic
1054693301 9:68335409-68335431 ACTCAAATGTTAAAATTCTTAGG + Intronic
1055533955 9:77217010-77217032 ACTCAAATGTTAATCTTCTTTGG + Intronic
1055771002 9:79717040-79717062 CCTTAAATGTCCACATTCTTTGG + Intronic
1055896585 9:81183902-81183924 CCACAAATGTTTAAATTCCTGGG - Intergenic
1056518568 9:87378476-87378498 ACTCAAATGTTAAACTCCTTTGG + Intergenic
1056644815 9:88401664-88401686 TCCCAAATGTTGAAAATCTGAGG + Intronic
1056857713 9:90149463-90149485 CCCCTAATAATGAAATTCTTAGG - Intergenic
1056947484 9:91011790-91011812 CCCCAAATGTTAAAATTCTGGGG - Intergenic
1057561839 9:96133964-96133986 CCTTGAATGTTGAAATTAGTAGG - Intergenic
1058006886 9:99925886-99925908 TCTCAAATGTAGAAAATCTTTGG + Intronic
1058124874 9:101179794-101179816 ACTCAAATGTTAATATCCTTTGG - Intronic
1058394385 9:104533687-104533709 CCCCAAATGTTGATCTTCCTAGG - Intergenic
1058646049 9:107132380-107132402 CCTCAGAGGTTGACATTCTAGGG + Intergenic
1058886344 9:109324115-109324137 CATCAAATATTGAAATTCTAAGG - Intergenic
1060081454 9:120650656-120650678 CCTCATATATTGAAAGTCTATGG - Intronic
1060144309 9:121238239-121238261 ACTCAAATGTTAACATCCTTTGG - Intronic
1061876577 9:133547094-133547116 CCTGCGATGTTGAAGTTCTTGGG - Exonic
1185545924 X:944167-944189 ACTCCAATGTTGATATCCTTTGG - Intergenic
1185710581 X:2300462-2300484 ACTCAAATGTTAAACTTGTTTGG - Intronic
1185816801 X:3163792-3163814 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1185979604 X:4762321-4762343 CCTAAACTGATGAAATTCTGTGG - Intergenic
1186304859 X:8245359-8245381 GCTCAAATGTTAAACTCCTTTGG + Intergenic
1186381362 X:9063605-9063627 ACCCAAATGTTGAAATTGTAGGG + Intronic
1190086731 X:47401631-47401653 ACTCAAATGGTGAAATTCTTAGG - Intronic
1190341742 X:49302294-49302316 GGTGAAATGTTGAAATTTTTCGG - Intergenic
1190343938 X:49320675-49320697 GGTGAAATGTTGAAATTTTTCGG - Intergenic
1190350685 X:49559480-49559502 GGTGAAATGTTGAAATTTTTCGG - Intronic
1190351787 X:49569038-49569060 GGTGAAATGTTGAAATTTTTCGG - Intergenic
1190355090 X:49597658-49597680 GGTGAAATGTTGAAATTTTTCGG - Intronic
1191095440 X:56668768-56668790 ACTCAAATGTTAATTTTCTTTGG + Intergenic
1191226735 X:58052074-58052096 ACTCAAATGTTAATTTTCTTTGG - Intergenic
1192047135 X:67687538-67687560 CCTCAATTGTTGGATTTCTTTGG - Intronic
1192082195 X:68059253-68059275 CTGCAAATGTTAAGATTCTTTGG - Intronic
1193528290 X:82620511-82620533 TCTCAAATATTCAAATGCTTAGG + Intergenic
1193706634 X:84828436-84828458 CCTCAAATTTAGAAAGTTTTTGG + Intergenic
1193776546 X:85649562-85649584 ACTCAAATGTTGATTTCCTTTGG + Intergenic
1194239614 X:91428269-91428291 CCAAAAATGTTGAATTTCTTTGG - Intergenic
1195055429 X:101139502-101139524 CTTCAAATGATAAAATTCCTTGG + Intronic
1195271682 X:103237309-103237331 ACTCAAATGTTAATATCCTTTGG + Intergenic
1195555941 X:106224314-106224336 CATCAAAAGATGAAATACTTAGG + Intergenic
1195896737 X:109752936-109752958 CTTTAAATCTTTAAATTCTTAGG - Intergenic
1197067628 X:122252669-122252691 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1197368344 X:125594968-125594990 TCTCACAGGTTGACATTCTTGGG - Intergenic
1197457015 X:126689422-126689444 ACTCAAATGTTAATCTTCTTTGG + Intergenic
1197592615 X:128427084-128427106 ACTCAAATGTTAAACTCCTTTGG + Intergenic
1197956065 X:131949923-131949945 ACTCAAATGTTAATCTTCTTTGG - Intergenic
1198300772 X:135332337-135332359 CTTCATATGTTGAAATCCTAAGG + Intronic
1198945729 X:142011411-142011433 CCTCCAATGGTGATATGCTTGGG + Intergenic
1199775134 X:151004082-151004104 CCTCAAATGCTGGAATTATAGGG + Intergenic
1201016314 Y:9606142-9606164 CCTTATATGTTGAGATTCTGAGG - Intergenic
1201629355 Y:16052593-16052615 ACTCAAATGTTAATTTTCTTTGG + Intergenic
1202364214 Y:24144794-24144816 CCTTAAATCTTTAAATTATTTGG + Intergenic
1202506566 Y:25525328-25525350 CCTTAAATCTTTAAATTATTTGG - Intergenic