ID: 1157304044

View in Genome Browser
Species Human (GRCh38)
Location 18:46503746-46503768
Sequence CCAGAAAAGCATGCAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 243}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157304044_1157304053 12 Left 1157304044 18:46503746-46503768 CCTTCCACTGCATGCTTTTCTGG 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1157304053 18:46503781-46503803 CGGATACACCCTGATATTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 40
1157304044_1157304050 10 Left 1157304044 18:46503746-46503768 CCTTCCACTGCATGCTTTTCTGG 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1157304050 18:46503779-46503801 CCCGGATACACCCTGATATTGGG 0: 1
1: 0
2: 0
3: 2
4: 46
1157304044_1157304047 -8 Left 1157304044 18:46503746-46503768 CCTTCCACTGCATGCTTTTCTGG 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1157304047 18:46503761-46503783 TTTTCTGGACAAGACTAACCCGG 0: 1
1: 0
2: 0
3: 8
4: 106
1157304044_1157304048 9 Left 1157304044 18:46503746-46503768 CCTTCCACTGCATGCTTTTCTGG 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1157304048 18:46503778-46503800 ACCCGGATACACCCTGATATTGG 0: 1
1: 0
2: 0
3: 3
4: 24
1157304044_1157304052 11 Left 1157304044 18:46503746-46503768 CCTTCCACTGCATGCTTTTCTGG 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1157304052 18:46503780-46503802 CCGGATACACCCTGATATTGGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1157304044_1157304054 13 Left 1157304044 18:46503746-46503768 CCTTCCACTGCATGCTTTTCTGG 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1157304054 18:46503782-46503804 GGATACACCCTGATATTGGGGGG 0: 1
1: 0
2: 0
3: 9
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157304044 Original CRISPR CCAGAAAAGCATGCAGTGGA AGG (reversed) Intronic
900297080 1:1957293-1957315 CCAGAAAAGCCTCCCGAGGAGGG - Intronic
900534077 1:3168358-3168380 CCAGAAAACCAGGCAGGGGTGGG - Intronic
901321547 1:8343246-8343268 CCAGCATGGCATGCAGGGGAGGG + Intronic
902332916 1:15739336-15739358 CCAGAAGAGCATGCTGAGGATGG - Exonic
902903095 1:19533788-19533810 CCAGCAAGGCAGGAAGTGGAAGG + Intergenic
904007013 1:27368430-27368452 CCAGAGGGGCATACAGTGGAAGG - Intergenic
904472226 1:30742973-30742995 ACAGAAGGGGATGCAGTGGAGGG - Intronic
904495937 1:30886709-30886731 CCAGAAAAGTGCTCAGTGGAAGG - Intronic
905265656 1:36752953-36752975 ACAGCAGACCATGCAGTGGAAGG - Intergenic
905305297 1:37013731-37013753 CCAGGGAAGAATGCAGAGGAGGG + Intronic
906710798 1:47928420-47928442 CATGAAATGCATGCAGTGCAAGG - Intronic
906774774 1:48519385-48519407 CCAGAAAAGAATGATCTGGAGGG + Intergenic
914345454 1:146794792-146794814 TCAGAGATGCATGCAGTTGAGGG - Intergenic
915403181 1:155639161-155639183 CCAGAAAAGCATGTAGTTTTTGG + Intergenic
915613189 1:157012531-157012553 CCAGAAAAGCATGGAAGTGAAGG - Intronic
915717508 1:157958363-157958385 CCAGAAAAGCATTGTGTGGGAGG + Intergenic
916011178 1:160707375-160707397 CAAGGAAAGGATTCAGTGGAGGG + Intronic
919043317 1:192420528-192420550 CCAGAGAAGCATTCAGAGGCTGG + Intergenic
919932421 1:202229964-202229986 TCTGAAAAGCAAGCAATGGAAGG - Intronic
922922012 1:229313410-229313432 CCAGACCAGCAGGCAGTGGAGGG + Intergenic
923558945 1:235023759-235023781 CCAGAAAAGCCTTCGGGGGAGGG + Intergenic
924274306 1:242369978-242370000 CCAGAAAAACATAAAATGGAGGG - Intronic
924812791 1:247417854-247417876 ACATAAAAGCTTGCAGAGGAGGG - Intronic
1063012739 10:2041292-2041314 GAGGAAAAGCATGCAGTGGATGG + Intergenic
1063675054 10:8133579-8133601 CTAGAAATGCAAGGAGTGGACGG - Intergenic
1063933485 10:11052842-11052864 CCAGTAAATCATGTAGTAGAGGG + Intronic
1063943626 10:11156472-11156494 CAAATAAAGCATGCAGGGGAGGG - Intronic
1067148926 10:43713814-43713836 GCCGAAAAGCATGCTGTGGATGG - Intergenic
1068281461 10:54876186-54876208 TCAGTAAACCATGCTGTGGAAGG - Intronic
1068952410 10:62790570-62790592 CCGGAATAGCCAGCAGTGGATGG - Intergenic
1069633614 10:69912472-69912494 CCAGAAAAGCCAGGTGTGGAGGG - Intronic
1069778631 10:70941254-70941276 CCAGAGAAGCATGGAGTGGAGGG - Intergenic
1070276344 10:75011363-75011385 TTAGAAAGGCATGCAGAGGAAGG - Intronic
1071146665 10:82582622-82582644 CCAAAAAAGAATGCAGAAGAGGG + Intronic
1072605903 10:96982474-96982496 CCGGAAAAGCTTTCAGTGGAGGG - Exonic
1072788069 10:98297673-98297695 AGAAAAAAGCATGCAGTGAAGGG + Intergenic
1073787417 10:106905528-106905550 CAAGAAAAGTTTGTAGTGGATGG + Intronic
1076841630 10:133048815-133048837 CCAGAACAGCAGGCAGAGGAGGG + Intergenic
1076879422 10:133232495-133232517 CCAGAAAAGCATGTGCAGGAGGG - Intergenic
1078545059 11:12241171-12241193 CCAAAACAGCATCCACTGGAAGG - Intronic
1081607111 11:44534251-44534273 CAAGAAAAGCGAGCAGGGGAGGG + Intergenic
1081928822 11:46853481-46853503 CCAGGGTAGCATGCAGTAGAGGG + Intergenic
1082699847 11:56414870-56414892 CAAGAAAAGCACTCAGTAGACGG - Intergenic
1084617859 11:70248270-70248292 CAAGAAAAGCATCCAGTGTCTGG + Intergenic
1085055178 11:73399104-73399126 CCAGAAAAGCTTCCAGGTGAGGG - Intergenic
1087111787 11:94477821-94477843 GCAGAAAAGGAAGCAGTGGGTGG + Intronic
1087215514 11:95488830-95488852 CCAAAATAGCATACAGTAGACGG + Intergenic
1088115794 11:106311317-106311339 CCAGAAAAGCACAATGTGGAAGG + Intergenic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089706123 11:120279189-120279211 CGAGACAAGCAGGCAGTGGTGGG - Intronic
1090280411 11:125451514-125451536 CCAGAACAGGCTGCAGTGGGCGG + Intronic
1091030831 11:132186321-132186343 CAAGGGAAGCAGGCAGTGGATGG + Intronic
1091729428 12:2869311-2869333 CCAGGATAGCGTGCAGTGGCTGG + Intronic
1095463696 12:42468297-42468319 GCAGAAGAGCATGTAGTAGATGG - Intronic
1096548691 12:52358348-52358370 CCAGAAGAGCTTGCTGTGGTGGG + Intergenic
1096613335 12:52817280-52817302 CCAGAGAAGAAAGCAGTGAACGG - Intergenic
1098012749 12:66071758-66071780 CAAGAGAAGCAAGAAGTGGAGGG - Intergenic
1098548902 12:71741253-71741275 CCAGACTAGCGTGCAGTGGTAGG - Intergenic
1098718430 12:73862308-73862330 ACAGAAAAGCATCCAGTACATGG + Intergenic
1099723597 12:86396643-86396665 GCAGAAAAGCAGGAAGTGGCAGG + Intronic
1101167105 12:102049748-102049770 CCAGAAAAGGAAGCAATGAATGG + Intronic
1101293331 12:103394685-103394707 GCAGGAAAGCAAGCACTGGAGGG + Intronic
1101934624 12:109047241-109047263 CCAGAAGAGGATGAAGTGTAGGG - Intronic
1102455610 12:113069247-113069269 CTAGCAAAGCAGGAAGTGGAGGG - Intronic
1104333765 12:127872816-127872838 CCAGCTAAGGTTGCAGTGGATGG + Intergenic
1105578421 13:21673674-21673696 CCAGAACAACAGGCAGTGGGCGG + Intronic
1107083214 13:36397278-36397300 GAAGAAAAGCATTCAGTGGTAGG - Intergenic
1108907440 13:55496599-55496621 CCAGAAAAGCTTTGAGTGGTAGG - Intergenic
1110528757 13:76571817-76571839 CATGAACAGCATGCAGGGGAGGG - Intergenic
1111878750 13:93929152-93929174 CCTGAAAGGCAAGCAGTGAAAGG - Intronic
1112399377 13:99062638-99062660 GCAGAAAAGCAGGCAGCGGATGG - Intronic
1113264930 13:108606826-108606848 CCATGAAAGCAGGGAGTGGAAGG + Intronic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1114603632 14:23977202-23977224 CCAGAAAAGAAAACAGTGAATGG - Intronic
1114608643 14:24019976-24019998 CCAGAAAAGAAAACAGTGAATGG - Intergenic
1114786797 14:25609453-25609475 GCTGTAAAGCATGCAGTGAAGGG + Intergenic
1115747803 14:36455661-36455683 TGAGAAAAGCAAGCAGAGGAAGG - Intergenic
1116747867 14:48844945-48844967 CTAGAAAAGCAGGCAGCAGAAGG + Intergenic
1117109063 14:52429802-52429824 CCTGAAAAGGATACAGAGGATGG + Intergenic
1117326306 14:54671990-54672012 ACAGAAAAGGAAGCAGTAGATGG - Intronic
1118348532 14:64957392-64957414 CCAGAGAACCCTGAAGTGGAAGG + Intronic
1119178111 14:72584530-72584552 CCAGATAACCATGCAGGGGTTGG + Intergenic
1119575599 14:75718712-75718734 TCAGAAAAGGATTCAGTGGAAGG + Intronic
1122012336 14:98760511-98760533 CCAGAAAGGAATGCAGGGGCTGG - Intergenic
1122540674 14:102496186-102496208 CCAGAAAAGCAGGCAGTGCCAGG + Intronic
1122800510 14:104227123-104227145 ACAGGAAAGCGTGCAGAGGAGGG - Intergenic
1123576750 15:21677077-21677099 CCACAAAAGCAAGCAGGGGTAGG - Intergenic
1123613372 15:22119545-22119567 CCACAAAAGCAAGCAGGGGTAGG - Intergenic
1124219373 15:27835883-27835905 CCTGAAAAGTATACAGTGGAGGG + Intronic
1125481812 15:40086207-40086229 ACAGAAGACCATGCTGTGGAAGG + Intergenic
1125527320 15:40385198-40385220 CCAGAAAAGCCTGCATGTGAGGG + Intronic
1127027936 15:54828827-54828849 CCAGCAAATCATGCAGTGCTGGG + Intergenic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1130559428 15:84946779-84946801 CCAGAAATGAAGGCAGGGGAGGG - Intergenic
1202985618 15_KI270727v1_random:411322-411344 CCACAAAAGCAAGCAGGGGTAGG - Intergenic
1133017593 16:2951442-2951464 CCAGAAGAGCTGGCACTGGAGGG - Intergenic
1133365573 16:5206473-5206495 GCAGGAAAGGATGCAGTGGGAGG + Intergenic
1137069061 16:35882836-35882858 CCAGAAAAGTATTCAGTGAATGG + Intergenic
1139469815 16:67172101-67172123 CCAGAGAAGGAGGCAGAGGAGGG + Intronic
1139921915 16:70466040-70466062 GCAGAAAGCCATCCAGTGGAGGG - Intronic
1140473225 16:75226325-75226347 CCAGAACAGCCGGCAGTTGATGG - Intergenic
1141855230 16:86676736-86676758 CCAGAAAAGCACAGAGTGGTAGG + Intergenic
1142009971 16:87708976-87708998 ACAAACAAGCATGCTGTGGACGG + Intronic
1142970321 17:3606884-3606906 CCTGCCCAGCATGCAGTGGATGG - Intergenic
1145390159 17:22449397-22449419 CTTGAAAAGCAGGTAGTGGAGGG + Intergenic
1149122736 17:53189763-53189785 CTAAAAAACCATGCAATGGATGG - Intergenic
1151686622 17:75650932-75650954 CCAGAAGAGGGTGGAGTGGAGGG + Intronic
1155395972 18:25387191-25387213 CCCCAAATGCATGCAGTGAAAGG + Intergenic
1155523780 18:26696093-26696115 CTATAGTAGCATGCAGTGGAAGG - Intergenic
1156060080 18:33063492-33063514 CCAGGAAAGCATGCAGGTGCTGG - Intronic
1156062923 18:33102837-33102859 CTACAAAAGCATGCAGGGGCTGG - Intronic
1157304044 18:46503746-46503768 CCAGAAAAGCATGCAGTGGAAGG - Intronic
1157338819 18:46760452-46760474 CCAAAAAACCATGCACTGGAAGG - Intergenic
1157555742 18:48612036-48612058 TCAGAAATGCATGAAGTCGAAGG - Intronic
1160954227 19:1682786-1682808 CCAGAAATGTCTGCTGTGGAGGG - Intergenic
1164669740 19:30065624-30065646 CCAGAAAAGCATGGGGTAGCAGG + Intergenic
1166659169 19:44634619-44634641 CCAGAAAAGAAAGAACTGGAGGG + Intronic
925469070 2:4139312-4139334 CCAGGCCAGCATGCAGTGGCAGG - Intergenic
925906330 2:8541734-8541756 TCAGAGAACCAGGCAGTGGAAGG + Intergenic
925996721 2:9299564-9299586 ACAGGAAAGCAAGCAGTGGAAGG + Intronic
928170896 2:29002479-29002501 CCAGAAGAACAGGGAGTGGAAGG - Intronic
929116692 2:38450702-38450724 CCAGAAAAGAATCCAGTGGGAGG - Intergenic
929378824 2:41324604-41324626 CAAGAATAGAATGCAGAGGAAGG + Intergenic
930326709 2:49929048-49929070 CCACCAAAGCATGCATTTGAAGG + Intronic
931537821 2:63298476-63298498 CTAGAAAAGCAAGCAGAAGAAGG + Intronic
931857359 2:66317370-66317392 CCACAAAACCAGGCAGTGGCAGG + Intergenic
933989230 2:87621760-87621782 CCTGATGAGCATCCAGTGGAAGG - Intergenic
935662397 2:105478345-105478367 CCAGAAAAGCAGGCCGGGCATGG - Intergenic
936304613 2:111329066-111329088 CCTGATGAGCATCCAGTGGAAGG + Intergenic
936828386 2:116609554-116609576 TCAGGAAAGCATACAGAGGAGGG + Intergenic
937028987 2:118722260-118722282 ACAGAAATGAGTGCAGTGGAAGG - Intergenic
940804267 2:158168361-158168383 AGAGAAAAGCATGCTCTGGATGG + Intergenic
941606446 2:167603265-167603287 CCACAGAATGATGCAGTGGAAGG + Intergenic
942318345 2:174714593-174714615 TTACAAAAGCAGGCAGTGGATGG - Intergenic
943563558 2:189491544-189491566 CATGAAGAGCATGCAGTTGAAGG - Intergenic
943848186 2:192678846-192678868 CAAGAAAAACATGCATTGGTTGG - Intergenic
944014818 2:195022759-195022781 CCTGAAATACATGCATTGGAAGG + Intergenic
945814152 2:214583349-214583371 CCAGAGAAGTATGCGGTTGAGGG - Intergenic
946961776 2:224993061-224993083 ACTGAAAATCAGGCAGTGGAAGG + Intronic
947134469 2:226963593-226963615 CCAGAAATCTAAGCAGTGGAGGG - Intronic
947746257 2:232508762-232508784 CCAGAAAAGCTGACCGTGGATGG - Intergenic
1173921455 20:46749217-46749239 CCAGAAAAGCATAGAATGGTGGG - Intergenic
1178677115 21:34640650-34640672 TGAGAAAGGCATGCAGTGGGAGG - Intergenic
1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG + Intronic
1178895125 21:36551400-36551422 CAAGAAAAGGAGGCAGTGGGAGG - Intronic
1179297303 21:40074894-40074916 TCAGAGAACCAGGCAGTGGAGGG + Intronic
1180246943 21:46554751-46554773 CCAGAAAAGGGGGCAGCGGAGGG - Intronic
1182029879 22:27150148-27150170 CCAGAAAACCAGGCATTGAAGGG + Intergenic
1182304657 22:29359547-29359569 CTAGCAAAGCATGCAGGGCAGGG + Intronic
1182710984 22:32323253-32323275 TGTGAAAAGCATGCAGGGGAGGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184405211 22:44296989-44297011 CCACAAAGGCATCCAGGGGAGGG - Intronic
949395039 3:3605846-3605868 TCAGAAAGGCATGGAGTGTATGG - Intergenic
954683073 3:52356299-52356321 CCAGCAAAGCCTGCAGTGACAGG - Intronic
955085603 3:55699488-55699510 CCAGAACAGAATGAAGTTGATGG - Exonic
956162778 3:66372480-66372502 CCAGAAATACAGGCAGAGGAGGG + Intronic
956650338 3:71499019-71499041 CCAGAACAAAATGCATTGGATGG + Intronic
957768379 3:84657025-84657047 TCAGAACAGCATGGAGAGGATGG - Intergenic
959236863 3:103734912-103734934 GTAGAAAAGAATGCAGTGAATGG + Intergenic
959302847 3:104624459-104624481 CTAGAAAAGCAGGCAGAAGAAGG + Intergenic
960518000 3:118623476-118623498 CCCCCAAAGCCTGCAGTGGAAGG + Intergenic
960689750 3:120333305-120333327 CCAGAAAAGCATGAATTCAAAGG + Intronic
961825636 3:129597712-129597734 CCAGACAGGCATCCAGTGGCAGG - Intronic
963805510 3:149717557-149717579 GGAGAAAATCCTGCAGTGGAGGG + Intronic
964129678 3:153272821-153272843 CCTGAGAAGCATACAGGGGAAGG + Intergenic
964603952 3:158538696-158538718 CCAAGAAAGCATGCATTGAAAGG + Intronic
965754998 3:172016689-172016711 AAAGAAAGACATGCAGTGGAAGG - Intergenic
966135445 3:176693075-176693097 CCAGAAAAGCATAAACTTGAGGG + Intergenic
968087271 3:195879429-195879451 CCAGAGAAGCATGGAAAGGAAGG + Intronic
968903912 4:3443188-3443210 CCAGAAAAGCAGGCAGCGTGGGG - Intronic
969114862 4:4865174-4865196 GAAGAAAAGCTTGCTGTGGAGGG + Intergenic
969725851 4:8917702-8917724 CCAGAAGAGCGTCCAGCGGAGGG - Intergenic
972933604 4:44104611-44104633 ACAGGAAAGGGTGCAGTGGAAGG + Intergenic
973908557 4:55555209-55555231 ACAGAGAATCATGAAGTGGAAGG - Intergenic
974060784 4:57033205-57033227 CCAGAAAAGCATGAAGTAACTGG - Exonic
978486443 4:109259918-109259940 CCAGCAAAGCATGCAATGCATGG - Intronic
978697103 4:111595690-111595712 GGACAAAAGCATGCCGTGGATGG - Intergenic
978703024 4:111672364-111672386 CCAGAAACACAAGCAGTGTATGG + Intergenic
979369207 4:119863151-119863173 ACTGAAAAGCATCCATTGGAAGG + Intergenic
979814333 4:125081113-125081135 CTACACAAGCATGCAGTGGTTGG - Intergenic
981950679 4:150403180-150403202 CCAGAAACACAGGCAGGGGAGGG + Intronic
985898226 5:2763269-2763291 CCAGCAAAGGATGCAGGGCAGGG - Intergenic
986545406 5:8891708-8891730 CTAATACAGCATGCAGTGGAGGG - Intergenic
987257826 5:16174919-16174941 ACACAAAAGAATGCAGTAGATGG + Intronic
987928897 5:24377540-24377562 CCAGAAAAGCATCCTCTGGATGG - Intergenic
988408092 5:30850171-30850193 ACAGAAGACCATGCTGTGGAGGG + Intergenic
988439502 5:31216326-31216348 ACACAAAAGCAGGCAGTGGCTGG - Intronic
988699529 5:33659767-33659789 ACAGAACAGCATTCAGTAGATGG - Intronic
988774913 5:34468985-34469007 CCAGAAATGCAAGGAGTGGGGGG + Intergenic
988976688 5:36522974-36522996 GCAGAAAAGCATGCATGGGCTGG + Intergenic
991616555 5:68502812-68502834 CCAAAAAAACATGGAGGGGAGGG + Intergenic
992079379 5:73219661-73219683 CCTGAAAGGCATGCAGAGGAGGG - Intergenic
992769416 5:80033622-80033644 GCTGACAAGCATGCAGTGGAAGG + Intronic
997822683 5:137079901-137079923 CCAGAAGAGCAGGCATGGGACGG - Intronic
997868277 5:137483953-137483975 CCAGACAAGCCTGCGGTGGGAGG + Intronic
998306282 5:141080277-141080299 CCAGAAAAGTAGGCAGGGGCTGG + Intergenic
998359814 5:141575258-141575280 CCAGAACAGGAGGCAGTGGGGGG - Intronic
999275337 5:150326176-150326198 CCAGAGAGGCATGGAGTGGAGGG - Intronic
999502688 5:152162641-152162663 CCAGAAAAGAAAGAAGTTGAGGG - Intergenic
999804135 5:155066404-155066426 CCAGCAGAGCATGAAGTGGAGGG + Intergenic
1001024533 5:168212917-168212939 GCAGAAGAGCAGGCAGTGGTGGG - Intronic
1003235329 6:4290314-4290336 CCTGAAAACCTTCCAGTGGAGGG + Intergenic
1004483038 6:16039137-16039159 CCAGAAAAGCCAGCAGTGAGGGG - Intergenic
1005118392 6:22363781-22363803 CCAGAGAGGCATGGAGTGCAGGG - Intergenic
1006807703 6:36799311-36799333 AAAGGAAAGAATGCAGTGGAAGG - Intronic
1007060161 6:38932700-38932722 GCAGCAAGGCATGAAGTGGATGG + Intronic
1008577856 6:52878544-52878566 CTAGAAAAGGATGCAGTCCATGG - Intronic
1008960181 6:57258596-57258618 CAAGAATGGCCTGCAGTGGAGGG - Intergenic
1009460959 6:63912702-63912724 CCAGAACAGCACCCAGGGGATGG - Intronic
1011398275 6:86933500-86933522 AAAGAGAAGCATGCACTGGAGGG + Intergenic
1011511574 6:88107128-88107150 CCAGAAATGCTTGAACTGGAAGG + Intergenic
1011645038 6:89449487-89449509 CCAGGAGAGCATGAAGGGGAAGG + Intronic
1012814880 6:104010677-104010699 CAAGAAATGCAGGCAGTGCAAGG + Intergenic
1016960502 6:149668371-149668393 CCAGGAAAGCATGAAGAGCAAGG + Intronic
1017600598 6:156076623-156076645 AAAGACAAGCATGCAGGGGAGGG + Intergenic
1017829915 6:158116902-158116924 TTATAAAAGCATGCATTGGAAGG - Intronic
1018453321 6:163929303-163929325 CCACAAAAGCAAGAAGTGAAAGG - Intergenic
1019422432 7:957316-957338 CCGGAACAGCAGGCAGTAGATGG - Intronic
1019633149 7:2060646-2060668 CCAGAAAGCCCTGAAGTGGACGG + Intronic
1021857438 7:24871180-24871202 CCAGAAACTCATTCAGTGGGAGG - Intronic
1022651280 7:32277924-32277946 CCAGAGAATCAGGCAGTGGGAGG + Intronic
1023075489 7:36478154-36478176 CCAGGAAAGCTTGAAGTGGAAGG - Intergenic
1023567448 7:41537728-41537750 CCAGCAAAGCATGGATTGCACGG + Intergenic
1025212116 7:57025780-57025802 CCTCCAAGGCATGCAGTGGACGG + Intergenic
1025659838 7:63551048-63551070 CCTCCAAGGCATGCAGTGGACGG - Intergenic
1027254668 7:76423618-76423640 GCAGGAAAGAATGCAGTGGTTGG + Intronic
1029675294 7:102064535-102064557 CCTCCAAGGCATGCAGTGGATGG + Intronic
1029814433 7:103078358-103078380 CGAGAAGAGCATGGAGGGGAGGG - Intronic
1030679942 7:112424110-112424132 CATGAACAGCATGCAGGGGAGGG + Intronic
1031651520 7:124296850-124296872 CCTGTAAAGCATGCATTGCAAGG - Intergenic
1032505033 7:132428152-132428174 CCAGAGAACCCTGCAGTGAAGGG + Intronic
1033590899 7:142807433-142807455 GAAAAAAAGCATGTAGTGGATGG + Intergenic
1033659465 7:143393652-143393674 CCAGGTAACCATGCAGGGGAAGG - Exonic
1035063870 7:156091396-156091418 ACAGAAAGCCATGCAGTGCATGG + Intergenic
1035293183 7:157853076-157853098 CCAGATCAGCAGGCAGTGGATGG + Intronic
1035304518 7:157923151-157923173 CTCTAAAAGCATGCAGTGTAGGG - Intronic
1036901997 8:12676978-12677000 GCAGAAAAGGATGCAGCGGGAGG - Intergenic
1038021426 8:23554609-23554631 CTAGAAAAGCCTCCAATGGATGG - Intronic
1038382374 8:27108222-27108244 ACAGAAAAGTATTCTGTGGATGG + Intergenic
1038575976 8:28703281-28703303 CTAGAAAAGCGAGAAGTGGAGGG - Intronic
1041023894 8:53665072-53665094 CCAGAACAGCATCAAGGGGATGG - Intergenic
1042338990 8:67659124-67659146 CAAGAAACGCATGGAGAGGAAGG - Intronic
1043557922 8:81455176-81455198 CCAGAGATGCATGCCGTGAATGG - Intergenic
1045052163 8:98337188-98337210 ACAGATAAGCCTGCAGGGGAAGG + Intergenic
1045102501 8:98859683-98859705 GTAGAAAAGCATGCCCTGGATGG - Intronic
1046418568 8:113948112-113948134 CCAGAACAGCATGAAGTCAAGGG + Intergenic
1047820158 8:128510624-128510646 CAGGAAAAGCATGCAGGGAAAGG - Intergenic
1048442353 8:134469313-134469335 CCAGGAAGGCATGCAGAGAAAGG - Intergenic
1048518653 8:135133918-135133940 GCAGAAAAGGATTCAGTGTAGGG - Intergenic
1048641378 8:136366555-136366577 ACGGTAAAGCATGCAGTGGCGGG - Intergenic
1049951072 9:644616-644638 CCAGAACAGCACCCAGGGGATGG + Intronic
1050113911 9:2243217-2243239 ACAGAAAAGAATGCAATGTAGGG + Intergenic
1053138602 9:35667487-35667509 CTACACAAGCATGCAGTGAAGGG + Intronic
1056244967 9:84685795-84685817 CTATAAGAGCATGTAGTGGAGGG - Intronic
1056450190 9:86709412-86709434 AGAGAAAAGCATTCAGTGGCAGG - Intergenic
1057286014 9:93754932-93754954 CCAGAAAAGAAAGAACTGGAGGG + Intergenic
1058564449 9:106266860-106266882 CCAGATAAGCATGAATTTGAGGG - Intergenic
1060032814 9:120230144-120230166 TCAGAAAATCATGCAGAGGTTGG - Intergenic
1061277193 9:129575977-129575999 GCAGAAGAGCCTTCAGTGGAGGG - Intergenic
1061422985 9:130482144-130482166 CCAGAGTGGCATGGAGTGGAGGG + Intronic
1186449794 X:9662518-9662540 CCAAAAAGACAGGCAGTGGAAGG + Intronic
1186990479 X:15061751-15061773 CCAGAAAAGCAAGGTGAGGAGGG + Intergenic
1188050225 X:25475631-25475653 CCAGAATATAATGCTGTGGATGG - Intergenic
1195254883 X:103081413-103081435 TCAGAAGAGAATGCAGTGGTCGG - Intronic
1195496745 X:105544801-105544823 ACTGAAAAGAATGCAGTGAAGGG - Intronic
1197862388 X:130984663-130984685 CCAGCAAAGCCTGCAGGGGAAGG + Intergenic
1198839721 X:140843490-140843512 CCAGGACAGCATGCAGGGGATGG - Intergenic
1199432177 X:147774052-147774074 TCTGAAAAGCTTGCAGGGGAAGG + Intergenic
1200424252 Y:3004579-3004601 CTAGAAAACAATGCACTGGAAGG + Intergenic