ID: 1157310898

View in Genome Browser
Species Human (GRCh38)
Location 18:46552502-46552524
Sequence GAGGCTAGGAGGGCTAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 0, 2: 0, 3: 51, 4: 587}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157310890_1157310898 12 Left 1157310890 18:46552467-46552489 CCATCTTAGGCTTCTCTGCTCTC 0: 1
1: 0
2: 4
3: 29
4: 335
Right 1157310898 18:46552502-46552524 GAGGCTAGGAGGGCTAGGAGTGG 0: 1
1: 0
2: 0
3: 51
4: 587
1157310886_1157310898 28 Left 1157310886 18:46552451-46552473 CCTCCTTGTGTTTCCACCATCTT 0: 1
1: 0
2: 5
3: 33
4: 326
Right 1157310898 18:46552502-46552524 GAGGCTAGGAGGGCTAGGAGTGG 0: 1
1: 0
2: 0
3: 51
4: 587
1157310887_1157310898 25 Left 1157310887 18:46552454-46552476 CCTTGTGTTTCCACCATCTTAGG 0: 1
1: 0
2: 3
3: 18
4: 142
Right 1157310898 18:46552502-46552524 GAGGCTAGGAGGGCTAGGAGTGG 0: 1
1: 0
2: 0
3: 51
4: 587
1157310893_1157310898 -10 Left 1157310893 18:46552489-46552511 CCAAACAGCCTCTGAGGCTAGGA 0: 1
1: 0
2: 1
3: 7
4: 167
Right 1157310898 18:46552502-46552524 GAGGCTAGGAGGGCTAGGAGTGG 0: 1
1: 0
2: 0
3: 51
4: 587
1157310889_1157310898 15 Left 1157310889 18:46552464-46552486 CCACCATCTTAGGCTTCTCTGCT 0: 1
1: 0
2: 0
3: 32
4: 311
Right 1157310898 18:46552502-46552524 GAGGCTAGGAGGGCTAGGAGTGG 0: 1
1: 0
2: 0
3: 51
4: 587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157310898 Original CRISPR GAGGCTAGGAGGGCTAGGAG TGG Intronic
900536265 1:3179251-3179273 GAGGCCAGCAGGGCCAGGACTGG + Intronic
900652255 1:3735391-3735413 GGGGCTGGGGGGGCTGGGAGAGG + Exonic
901012514 1:6209664-6209686 GTTGCTAGGAGAGCTGGGAGGGG + Intronic
901049756 1:6420181-6420203 GAGGGCAGGAGGGCCAGGTGGGG + Intronic
901264906 1:7903014-7903036 GAGGGGAGGAGGGGAAGGAGGGG - Intergenic
901511321 1:9719368-9719390 GAAGCCAGGAGGGCCAGGCGTGG + Intronic
901524365 1:9810137-9810159 GAGGAAAGGAGGGGAAGGAGGGG + Intronic
901966107 1:12868002-12868024 GGGGTGTGGAGGGCTAGGAGAGG - Intronic
901981498 1:13038255-13038277 GGGGTGTGGAGGGCTAGGAGAGG - Intronic
902000584 1:13190658-13190680 GGGGTGTGGAGGGCTAGGAGAGG + Intergenic
902019828 1:13336425-13336447 GGGGTGTGGAGGGCTAGGAGAGG + Intergenic
902315718 1:15617281-15617303 GAGGATAGGAGGGGGAGGAGTGG - Intergenic
902439639 1:16421116-16421138 GAGGGAAGGATGGCTGGGAGGGG + Intronic
902505816 1:16938616-16938638 GAGGCTGGGTGAGCTAGCAGGGG - Intronic
903817634 1:26076211-26076233 GAGGCAAGTAGGGTCAGGAGGGG + Intergenic
903918971 1:26786242-26786264 AAGGCTAGGTGGGATAGGAGGGG - Intergenic
904611651 1:31729123-31729145 GGGACAAGGAGGGCCAGGAGAGG - Intronic
904905772 1:33896227-33896249 GGGGGTAGGAGGGTAAGGAGGGG + Intronic
905418597 1:37822588-37822610 GAGGCTGGGGTGGCTCGGAGAGG + Exonic
906679775 1:47718324-47718346 GAGGATAGGAGGAAAAGGAGAGG - Intergenic
907308341 1:53525809-53525831 GATGCGAGGAGAGCTTGGAGAGG - Intronic
907459151 1:54594819-54594841 GGAGCCAAGAGGGCTAGGAGAGG - Intronic
907844582 1:58192229-58192251 GGGGCTGGCAGGGCTAGGAATGG + Intronic
908128044 1:61050215-61050237 GAGGGCAGGGGGGCTGGGAGAGG - Intronic
909023650 1:70459996-70460018 CAGGCCTGGAGGCCTAGGAGAGG + Intergenic
909386483 1:75063405-75063427 GAGGCTGGGAAGCCTAGTAGGGG - Intergenic
909719252 1:78748655-78748677 GAGGCCCGGATGGCTAGGACAGG - Intergenic
910700147 1:90064483-90064505 GAGGGTTGGGGGGCTAGGGGAGG + Intergenic
911564777 1:99450951-99450973 GAGGCTAGGAAGGGTATTAGTGG + Intergenic
911773553 1:101778509-101778531 GAGGCCAGGAAGGGTAGTAGGGG - Intergenic
912469600 1:109897290-109897312 AATGCTGGGAGGGCCAGGAGGGG - Intergenic
913330433 1:117662887-117662909 TAGGCTCAGAGGCCTAGGAGGGG + Intergenic
913645585 1:120851068-120851090 AGGGCTAGGAGGGCTGGGGGGGG - Intergenic
914005572 1:143729664-143729686 AGGGCTAGGAGGGCTGGGGGTGG - Intergenic
914081124 1:144412458-144412480 AGGGCTAGGAGGGCTGGGGGCGG + Intergenic
914096246 1:144546633-144546655 AGGGCTAGGAGGGCTCGGGGTGG - Intergenic
914098037 1:144560910-144560932 AGGGCTAGGAGGGCTGGGGGGGG - Intergenic
914300940 1:146376690-146376712 AGGGCTAGGAGGGCTGGGGGTGG + Intergenic
914302275 1:146387330-146387352 AGGGCTAGGAGGGCTGGGGGTGG + Intergenic
914405067 1:147362410-147362432 GGGGGTTGGAGGGCTAGGGGAGG + Intergenic
914514513 1:148362629-148362651 AGGGCTAGGAGGGCTGGGGGTGG - Intergenic
915076712 1:153313602-153313624 GAGGCTGTGGGGTCTAGGAGAGG - Intergenic
915130661 1:153693422-153693444 GAGGTGTGGAGGGATAGGAGAGG - Exonic
915337804 1:155157265-155157287 GAGGCTGGGAAGGATAGTAGGGG + Intergenic
915493823 1:156267068-156267090 GAGGTAAGGAGGGATAGGACTGG - Intronic
915693402 1:157714261-157714283 GAGGCTGGGAAGGATAGTAGAGG - Intergenic
916670693 1:167016978-167017000 GAGGCTAGGAAGGGTACTAGAGG + Intronic
917300049 1:173563849-173563871 GAGGCTGGGAAGGGTAGTAGGGG - Intronic
918066449 1:181105140-181105162 GAGGTCAGGAGGGCTGGGGGCGG + Intergenic
918596804 1:186303842-186303864 GAGGCTCGCAGGCCTAGGACTGG + Intronic
918644819 1:186891454-186891476 GAGGCTGGGAAGGGTAGTAGGGG - Intronic
918663129 1:187114244-187114266 GAGGCTGGGAAGGGTAGTAGGGG + Intergenic
918946390 1:191070871-191070893 GGGGCTGGGAGGCCTAGGGGAGG + Intergenic
919240808 1:194914156-194914178 GGGGCGGGGTGGGCTAGGAGTGG - Intergenic
919880004 1:201895017-201895039 GAGGGAGGGAGGGGTAGGAGGGG + Intergenic
920287520 1:204891227-204891249 CAGGCAAGAAGGGCGAGGAGAGG + Intronic
920387684 1:205580206-205580228 GAGGGAAGGAGGGGAAGGAGAGG - Intronic
921469482 1:215531469-215531491 GAGGCTAGCTGGGCTAGATGGGG + Intergenic
921701715 1:218276041-218276063 GAGGTTAGAAGGGCTATGAAGGG - Intergenic
922843778 1:228666579-228666601 GAGGCTAGGAAGGATAGGAAGGG - Intergenic
922902785 1:229150259-229150281 GGGGCTAGGAAGGGTAGTAGTGG + Intergenic
923081608 1:230662021-230662043 GAGGAGAGGAGGGAGAGGAGAGG - Intronic
923485144 1:234422581-234422603 GAGGCTGGGAGGGGTAGTGGTGG + Intronic
1063493589 10:6486915-6486937 GAGGCTAGCAATGCCAGGAGAGG + Intronic
1063869129 10:10399400-10399422 GAGTCTGGGAAGGGTAGGAGTGG - Intergenic
1063942125 10:11141380-11141402 GAGACTCGGAGGGGTAGGATGGG + Intronic
1064149341 10:12849670-12849692 GAGGCTGTGCGGGCAAGGAGAGG + Intergenic
1064563339 10:16614355-16614377 GAGGCTGGAAGGGGTAGTAGGGG + Intronic
1064963537 10:20992638-20992660 GAGGGTAGGAGAGCTAGGTCTGG - Intronic
1065289476 10:24215286-24215308 GAGGCTGGGAGGGGCAGGAAAGG + Intronic
1065810047 10:29433886-29433908 GAGGCTAGAAAGGGTAGTAGGGG - Intergenic
1066083451 10:31954980-31955002 CAGGCCTGGAGGCCTAGGAGGGG + Intergenic
1067095773 10:43298684-43298706 CAGGTTAGGAGGCCGAGGAGGGG - Intergenic
1067999990 10:51321610-51321632 GAGGCTGGGAAGGGTAGTAGCGG + Intronic
1068032293 10:51718767-51718789 GAGGCTGGGAAGGGTAGTAGGGG + Intronic
1068168348 10:53360089-53360111 GAGGCTGGGAAGGGTAGTAGGGG - Intergenic
1068340963 10:55701988-55702010 CAGGGTTGGGGGGCTAGGAGAGG + Intergenic
1068738156 10:60438287-60438309 GAGGCTTGGATGGCCAGGACAGG + Intronic
1069900847 10:71705839-71705861 GAGGCCAGCAGAGCTAGGATGGG - Intronic
1070219615 10:74426933-74426955 GAGGCTTGGGGGGTTAGGGGAGG - Intronic
1070363953 10:75717594-75717616 GAGGCAAGGAGGGTGATGAGTGG + Intronic
1070711478 10:78686264-78686286 GGGGCCGGGAGGGCTGGGAGTGG - Intergenic
1070787039 10:79167949-79167971 AAGGCTAGGAGGGAGAAGAGGGG + Intronic
1070837380 10:79458227-79458249 GAGGCTGGGAGGGCAGGGACAGG - Intergenic
1070874028 10:79784459-79784481 CAGGCTGGCAGTGCTAGGAGAGG - Intergenic
1070939669 10:80333287-80333309 GAGGCTGGGAGGGATAGTGGGGG + Intergenic
1071007827 10:80903047-80903069 GAGGCTGGGAGGGGTAGTGGGGG - Intergenic
1071640960 10:87306598-87306620 GAGGCTGGCAGTGCTAGGAGAGG - Intergenic
1071654276 10:87431338-87431360 GAGGCTGGCAGTGCTAGGAGAGG + Intergenic
1071885756 10:89949016-89949038 GAGGCTAGGAAGGGTAGTAGGGG + Intergenic
1073062683 10:100741924-100741946 GCGGCTAGGGGAGCTAGGACCGG - Intronic
1073260834 10:102188935-102188957 GAGCCTACAAGGGCAAGGAGGGG + Intergenic
1073564045 10:104520191-104520213 GAGGCTTGGAAGGGTAGTAGGGG + Intergenic
1074199545 10:111222697-111222719 GAAACTAGGAGGGCTTGGGGTGG - Intergenic
1074421945 10:113316891-113316913 GAGGGGAGGAGGGCCAAGAGTGG + Intergenic
1074435659 10:113432087-113432109 GAGGTTAGGAGGGGCGGGAGAGG + Intergenic
1074929251 10:118106801-118106823 GAGCCTAGGAGGGGTAAGATAGG + Intergenic
1076304793 10:129457930-129457952 GTGGCTAGCAGGGTTAGGAGGGG + Intergenic
1076570301 10:131428308-131428330 GAGGCTAATGGGGCTGGGAGTGG - Intergenic
1077014290 11:393077-393099 AAGCCTAGGAGGGCTGGGGGTGG - Intronic
1077106599 11:844943-844965 GGGACCAGGAGGGCTGGGAGGGG + Intronic
1077152376 11:1078045-1078067 GAGGCCCGGAGGGCTTGGAGGGG + Intergenic
1077365381 11:2159414-2159436 GAACCTGGGAGGGCTAGGTGGGG + Intronic
1078745923 11:14114202-14114224 GAGGCTGGGAAGGCTAGTAGGGG - Intronic
1079103696 11:17557378-17557400 CAGGCTGGGAGGGGTTGGAGGGG + Intronic
1079512577 11:21228706-21228728 GAGGGAAGGAGGGGTGGGAGGGG - Intronic
1083773044 11:64878877-64878899 GCGGTTAGGAAGGCGAGGAGCGG + Intronic
1083841872 11:65309204-65309226 GAGGCTGGGAGGGGAAGGAAGGG + Intergenic
1084179795 11:67440595-67440617 GAAGCCAGGAGGGCCAGGTGGGG - Intronic
1084461002 11:69296540-69296562 GAGGGTAGGAGAGTTGGGAGAGG - Exonic
1084484365 11:69439250-69439272 GAGGCTGGGAGGGCCAGGTGTGG - Intergenic
1084905556 11:72343605-72343627 GAGGCTAGGAGGAAGGGGAGAGG + Intronic
1085179049 11:74517969-74517991 GAGGCTAGGAAGGGTAGTTGGGG + Intronic
1085415898 11:76318828-76318850 GAGGCTTGGAGGGGTAGGGTGGG - Intergenic
1086210230 11:84309387-84309409 GAGCACAGAAGGGCTAGGAGAGG + Intronic
1086737917 11:90329908-90329930 GAGGGGAGGAGGGGGAGGAGGGG - Intergenic
1087009956 11:93503720-93503742 AAGGCTGGGAGAGCAAGGAGTGG + Intronic
1087807333 11:102569093-102569115 CAGGCCCGGAGGCCTAGGAGGGG - Intergenic
1088575489 11:111267298-111267320 GAGGCCAGGGGGTCCAGGAGTGG - Intronic
1088656279 11:112003079-112003101 GAGGCTGGGAAGGCTTGGGGAGG + Intronic
1089084899 11:115808668-115808690 GTGGGTAGGAGGCCAAGGAGTGG + Intergenic
1089684292 11:120137192-120137214 GAGGCCTGGAGGGGCAGGAGGGG + Intronic
1089937855 11:122384267-122384289 GAGGCTGGGAAGGATAGTAGGGG + Intergenic
1090422993 11:126588514-126588536 GAGGCAGGGAGGGGAAGGAGAGG + Intronic
1091383679 12:78398-78420 GAGGCGGGGGCGGCTAGGAGGGG + Intronic
1091986062 12:4910877-4910899 CAGGCGAAGAGGGGTAGGAGGGG + Exonic
1092238516 12:6823890-6823912 GAGGATAGGATGGCTCGGGGCGG + Exonic
1092458488 12:8665984-8666006 GAGGCAGGGAGGGCAGGGAGAGG + Intergenic
1093476000 12:19555042-19555064 GAGGCTAGGAAGGGTAGTGGGGG - Intronic
1093602092 12:21039906-21039928 GAGGCTGGGAAGGGTAGCAGAGG - Intronic
1093990405 12:25583706-25583728 GAGCCTAGTAAGGCTGGGAGAGG + Intronic
1094449542 12:30570030-30570052 GAGGCTGGGAAGGCTAGTTGGGG - Intergenic
1095953895 12:47795860-47795882 GAAGCTGGGGGGGCTTGGAGTGG + Intronic
1096014310 12:48254404-48254426 GAGGCTAGGAAGGGTAGTTGGGG + Intergenic
1096239568 12:49952460-49952482 AAGGCTAGGTGGGCAAGCAGAGG + Intronic
1096657984 12:53103610-53103632 GAGGACAGAAGGGCTGGGAGGGG + Exonic
1096743575 12:53711623-53711645 GAAGCAACCAGGGCTAGGAGTGG + Intronic
1096873209 12:54607755-54607777 GGAGCTTGGAGAGCTAGGAGAGG + Intergenic
1097563901 12:61242899-61242921 GAGGCTAGGAAGGGTAGTTGAGG + Intergenic
1098047723 12:66419291-66419313 GAGGCTAGGAAGGGTAGTGGGGG + Intronic
1098142477 12:67464414-67464436 GAGGCTGGGAAGGGTAGTAGGGG - Intergenic
1098165072 12:67687836-67687858 GAGGCTAGGAAGGGTAGTGGGGG + Intergenic
1098207332 12:68125732-68125754 GAGGCTGGGAAGGGTAGTAGGGG - Intergenic
1099172887 12:79386493-79386515 GGGGGTTGGGGGGCTAGGAGAGG - Intronic
1099206620 12:79735948-79735970 GAGGCTAGGAAGGATACCAGAGG + Intergenic
1099206624 12:79735967-79735989 GAGGCTAGGAAGGATACCAGAGG + Intergenic
1100300053 12:93298519-93298541 GAGGCTGGGACGGGTAGGTGGGG + Intergenic
1100549780 12:95636399-95636421 GAGGGGAGGAGGGAGAGGAGTGG - Intergenic
1100804181 12:98263748-98263770 GAGCATAGGAGGGAGAGGAGAGG - Intergenic
1102737853 12:115179126-115179148 GAGGAAAGGAGAGCAAGGAGGGG + Intergenic
1103710681 12:122910256-122910278 GAGCCTGGGAGGGCGAGGAACGG + Intergenic
1104283002 12:127395108-127395130 GAAGCTGGGAGGGAGAGGAGTGG + Intergenic
1105389177 13:19959119-19959141 GAGGCCGGGAGGGCTGGGTGAGG + Intronic
1105421863 13:20259892-20259914 GAGGCTAGGAAGAGCAGGAGTGG - Intergenic
1105682291 13:22741408-22741430 GAGGCTGGGAAGGATGGGAGTGG + Intergenic
1106215374 13:27693071-27693093 GAGGCAAGGAGGACTATGTGTGG + Intergenic
1107176745 13:37407721-37407743 GGGGATGGGAGGGCTAGGGGAGG + Intergenic
1108328999 13:49366148-49366170 GAGGCTAGGAAGGGTAGCAGGGG + Intronic
1108618460 13:52158917-52158939 GAGGCTAGGATAACTGGGAGAGG + Intronic
1108701294 13:52946623-52946645 GAGGCTGGGAAGGGTAGTAGGGG + Intergenic
1109247194 13:59969533-59969555 GTGACTAGGGGAGCTAGGAGAGG - Intronic
1109429733 13:62216281-62216303 GGGGGTGGGAGGGCTAGCAGAGG - Intergenic
1110155599 13:72313103-72313125 CAGGCTAGGAGGTAGAGGAGTGG + Intergenic
1110489559 13:76087228-76087250 CAGGCTGAGAGGCCTAGGAGGGG - Intergenic
1110888672 13:80671079-80671101 GAGGCTAGGAAGGTTAGTGGAGG - Intergenic
1111390520 13:87588669-87588691 GGGGGCTGGAGGGCTAGGAGAGG + Intergenic
1111951187 13:94711051-94711073 GAGGCCAGGCGGGGCAGGAGTGG - Exonic
1112512204 13:100020001-100020023 CAGGCCTGGAGGCCTAGGAGGGG + Intergenic
1112569890 13:100584470-100584492 GAGGCTAGGAAGGGTAGTAGGGG + Intronic
1113143732 13:107183842-107183864 GAGGGGAGGAGGGCTGGGGGAGG + Intronic
1114664470 14:24369677-24369699 GAGGCTGGGAGGACCAGGAGGGG + Exonic
1114714497 14:24810377-24810399 GAGGCTGGGAGGTAAAGGAGGGG + Exonic
1114840444 14:26256727-26256749 GAGTCTAGGATGGGTACGAGTGG + Intergenic
1114991833 14:28297838-28297860 CAGGCCCAGAGGGCTAGGAGAGG + Intergenic
1115144371 14:30209530-30209552 GAGGCTAGGAAGTCTAAGATGGG + Intergenic
1115276324 14:31613288-31613310 GAGGCTGGGAAGGGTAGTAGGGG + Intronic
1116045869 14:39741678-39741700 GAGGCTGGGAAGGCCAGCAGGGG - Intergenic
1116149395 14:41119778-41119800 GAGGCTGGGAAGGGTAGTAGGGG + Intergenic
1116153946 14:41179136-41179158 GAGACTAGGAAGGGTAGTAGAGG - Intergenic
1116683531 14:48008933-48008955 GAGGCTAGGAGAGGTAAGGGAGG + Intergenic
1117072019 14:52066267-52066289 GAGGCTGGGAAGGGTAGTAGGGG + Intronic
1117264106 14:54067780-54067802 GAGGCTGGGAAGGGTAGCAGGGG - Intergenic
1117732622 14:58738986-58739008 GAGGCCAGGAGGAATGGGAGAGG + Intergenic
1118538507 14:66795982-66796004 GAGGCTAGGAAGGGTAGAGGGGG - Intronic
1118893071 14:69925066-69925088 GAGAGTAGGGGAGCTAGGAGAGG + Intronic
1118893098 14:69925151-69925173 GAGAGTAGGGGAGCTAGGAGAGG + Intronic
1119437262 14:74605577-74605599 GGGGCTAGGAGGGCTCTGAGAGG + Intronic
1120262554 14:82205165-82205187 GAGGCTGGGAAGGGTAGTAGGGG - Intergenic
1120668971 14:87342087-87342109 GAGGCTAGGAAGGATAGTTGGGG + Intergenic
1120775732 14:88435575-88435597 GAGGCTGGGAAGGGTAGTAGAGG - Intronic
1121109395 14:91302441-91302463 GATCCAGGGAGGGCTAGGAGAGG - Intronic
1121554299 14:94824596-94824618 GAGGGGAGCAGGGTTAGGAGGGG + Intergenic
1122087006 14:99314771-99314793 CATGCTAGGTGGGCTTGGAGAGG - Intergenic
1122088050 14:99320587-99320609 GGGGCTGGGAGGCCGAGGAGAGG + Intergenic
1122415527 14:101547934-101547956 GGGGGGAGGAGGGGTAGGAGGGG - Intergenic
1122609119 14:102969290-102969312 GGGGCAAGGAGGGGCAGGAGAGG + Intronic
1122910617 14:104826151-104826173 TGGGCTGGGAGGGCTAGGTGGGG + Intergenic
1124109509 15:26773094-26773116 GAGGGGAGGAGGGGGAGGAGCGG + Intronic
1125357501 15:38831725-38831747 GGGGGTAGGGAGGCTAGGAGAGG - Intergenic
1125535290 15:40438796-40438818 GAGGCCGGGAGGGCCAGAAGAGG - Intergenic
1125795195 15:42399155-42399177 GAGGCTGGGAAGGGAAGGAGAGG - Intronic
1126042155 15:44601870-44601892 GAGGCTGGGTGGGCTGGGCGCGG - Intronic
1126466249 15:48963729-48963751 GAGGGTAGGCAGGCTGGGAGGGG - Intergenic
1126717298 15:51532373-51532395 GAGGCTAGGAGGGGTCGTAAGGG + Intronic
1126765196 15:52004591-52004613 GAGGCTGGGAAGTCTAAGAGGGG + Intronic
1126979184 15:54222244-54222266 GAGGCTGGGAAGGGTAGGGGTGG - Intronic
1127788647 15:62378740-62378762 GAGGCAAGGTGGGAAAGGAGAGG + Intergenic
1127899869 15:63333202-63333224 GAGGCTAAGAGGGCAGGGATGGG + Intronic
1127931900 15:63602289-63602311 GAGGGTAGAAGGGCCAGGTGCGG + Exonic
1128242560 15:66110931-66110953 GAGGTTTGGAGGGGGAGGAGGGG - Intronic
1128278017 15:66370478-66370500 GAGGGGAGGAGGGCCAGCAGGGG + Intronic
1128796243 15:70468765-70468787 GAGGATAAGAAGGGTAGGAGAGG + Intergenic
1128859929 15:71060495-71060517 GAGGCTAGGAAGGGTAGTAGTGG - Intergenic
1129691337 15:77715288-77715310 GTGGCTTGGGGGCCTAGGAGGGG + Intronic
1129933072 15:79428335-79428357 GAGGCAAGGAGGGATGGGGGAGG - Intergenic
1130073591 15:80669801-80669823 AAATCTTGGAGGGCTAGGAGGGG - Intergenic
1130103480 15:80911905-80911927 GAGGCTGGGATTGCTGGGAGAGG + Intronic
1130103493 15:80911962-80911984 AAGGCTGGGAGAGCTGGGAGAGG + Intronic
1130103498 15:80911981-80912003 GAGGCTGGGAGAGCTGGGAGAGG + Intronic
1130103509 15:80912029-80912051 GAGGCTGGGAGAGCTGGGAGAGG + Intronic
1130103517 15:80912067-80912089 AAGGCTGGGAGAGCTGGGAGAGG + Intronic
1130103522 15:80912086-80912108 GAGGCTGGGAGAGCTGGGAGAGG + Intronic
1130399869 15:83540936-83540958 GAGGCTGGGAAGGGTAGCAGGGG - Intronic
1131634545 15:94217309-94217331 GAGGCTGGGAAGGGTAGCAGGGG + Intergenic
1132671190 16:1102873-1102895 GAGACTAGGAGGGCCTGTAGGGG - Intergenic
1132794687 16:1713955-1713977 GGGGCAAGGAGGGGTCGGAGGGG - Intronic
1133240771 16:4413052-4413074 ATGGCCAGGAGGGCTGGGAGGGG - Intronic
1133902058 16:9985691-9985713 GAGGCTAGGAAGGGTAGTTGGGG + Intronic
1134128105 16:11630196-11630218 GAGGCTAGGAGGGGAAGTTGGGG - Intronic
1134910010 16:18017263-18017285 GAGGGTTGGGGGGCTAGGGGAGG - Intergenic
1135353678 16:21751788-21751810 GAGGCCAGGATGGTTTGGAGTGG + Intronic
1135452167 16:22567916-22567938 GAGGCCAGGATGGTTTGGAGTGG + Intergenic
1135574369 16:23573908-23573930 GAGGCAAGGAGCGAGAGGAGAGG - Exonic
1135876433 16:26204599-26204621 GAGGCTGGGAAGGGTAGTAGGGG + Intergenic
1135927099 16:26705033-26705055 GAGGAAAGGTGGGGTAGGAGTGG + Intergenic
1136064206 16:27747753-27747775 GAGGCTGGGAGGGGTGGGAGGGG + Intronic
1136097110 16:27964766-27964788 GAGGCTGGGAAGGGTAGTAGGGG + Intronic
1136107404 16:28040038-28040060 GAGGCCAGCAGGGGAAGGAGAGG - Intronic
1136144347 16:28307124-28307146 GAGGCTGGGGGTGCTAGAAGAGG + Intronic
1136395945 16:29992599-29992621 GAGGCCTAGAGGGCTAGGACTGG + Exonic
1137527897 16:49252597-49252619 GAGGCTGGGAAGGGTAGCAGAGG + Intergenic
1137886261 16:52106995-52107017 GAGGCAAAGAGGCCTTGGAGTGG + Intergenic
1139436702 16:66940735-66940757 GAGGCTCTGAGGGATATGAGGGG - Intronic
1139739682 16:69024555-69024577 GAGGCTAGAGGGGCCAGGAGGGG - Intronic
1140584269 16:76270279-76270301 GAGGCTGGGAAGGGTGGGAGAGG + Intergenic
1140969514 16:79999404-79999426 GAGGCCAGGAAAGCTGGGAGTGG - Intergenic
1141139663 16:81489170-81489192 GAGGAAAGGCGGGCAAGGAGGGG + Intronic
1141476078 16:84274377-84274399 GAAGCCAGGAGGGCTGGCAGGGG - Intergenic
1141764497 16:86049514-86049536 CAGGCTTGGGGGGGTAGGAGAGG - Intergenic
1141974617 16:87507285-87507307 GAGGCTAGTACGGCTCAGAGAGG + Intergenic
1142765216 17:2060627-2060649 GAGGGTAGGCGGGCAAGGAGGGG + Exonic
1142961695 17:3555747-3555769 GAGCCTGGGAGGGTCAGGAGTGG + Intronic
1142973817 17:3631142-3631164 GAGGAGAGGAGGGGTAGGATGGG + Intronic
1142994114 17:3750914-3750936 GAAGCTGGGTGGGCTGGGAGTGG + Intronic
1143415555 17:6746404-6746426 GAGGCTGGGAAGGGTAGTAGTGG + Intergenic
1143420352 17:6786340-6786362 GAGGCTGGGAAGGGTAGTAGGGG + Intronic
1143577317 17:7801804-7801826 GAGGCTGGGAGTGCGATGAGAGG - Intronic
1143587482 17:7857569-7857591 GAGACTAGGAGGGGGAGGAGAGG - Exonic
1144182134 17:12762358-12762380 GTGGCTTGGAGGGTTGGGAGAGG + Intronic
1144955522 17:19017099-19017121 CAGGCTTGCAGGGCTAGGGGCGG - Intronic
1145391764 17:22460725-22460747 GGGGCTGGGAGGGCCTGGAGTGG + Intergenic
1145906812 17:28520885-28520907 CAGGCAAGGAGGGCTAGCAAGGG + Intronic
1145994394 17:29097174-29097196 GTGCCTGGGAGGGCCAGGAGAGG - Intronic
1146197264 17:30824441-30824463 AAGGCTGGGAGGGCTTTGAGGGG - Intronic
1146284486 17:31565212-31565234 GAGGATGGGAGGGCTGGGGGAGG + Intergenic
1146371349 17:32266840-32266862 GAGGCAAAGAGTGCTGGGAGCGG + Intronic
1146765684 17:35519188-35519210 GAGGGTAGGGGGGCAAGGAGAGG + Intronic
1147264099 17:39224854-39224876 GAGCCCAACAGGGCTAGGAGCGG + Intronic
1147591774 17:41688676-41688698 GACTCTAGGAGAGCTGGGAGGGG - Intergenic
1147763774 17:42818995-42819017 GAGGTCAGTCGGGCTAGGAGTGG - Intronic
1147947242 17:44086966-44086988 GAGGCTGGGAGGGGTGGGGGCGG + Intronic
1148232914 17:45948293-45948315 GAGCCCAGGAGGGCTGGGTGCGG - Intronic
1148463717 17:47851982-47852004 AAGGACAGGAGGGCGAGGAGAGG - Intronic
1148545908 17:48518921-48518943 GAGGATAGGTGGGCTGGGATGGG - Intergenic
1151157076 17:72132615-72132637 GAGGATGGGATGGCTAAGAGAGG + Intergenic
1151421964 17:74004672-74004694 GAGGGTGGGAGGGGCAGGAGAGG + Intergenic
1151473591 17:74332651-74332673 TAGGCCAGGAGGGCTGGGTGAGG + Intronic
1151971522 17:77459964-77459986 GAGTCTGGGAGGGCTGGGTGAGG - Intronic
1152293618 17:79454379-79454401 CAGGCCAGGAGGGGCAGGAGGGG - Intronic
1152617598 17:81345123-81345145 GGGGCTCCGGGGGCTAGGAGGGG + Intergenic
1152799292 17:82323492-82323514 GAAGGTGGGAGGGCTGGGAGGGG + Intronic
1153011401 18:542956-542978 GAGGCTGGGTGGGCTGGGTGTGG - Intergenic
1153120958 18:1726291-1726313 GAGGCTGGGAAGGATAGTAGGGG - Intergenic
1153430591 18:5012181-5012203 GAGGCTAGGAAGGGTAGTTGGGG + Intergenic
1153837067 18:8972851-8972873 GAGGCTAGGAAGGGTAGGTGGGG - Intergenic
1153858834 18:9177735-9177757 GAGGCTAGGAAGGGTACGTGTGG - Intronic
1155534398 18:26802006-26802028 GAGGCTAGGAAGGATAGCAGGGG + Intergenic
1155621431 18:27784842-27784864 AAGCATAGCAGGGCTAGGAGGGG + Intergenic
1157213749 18:45764864-45764886 GAGACTAGAAGGGCCAGGGGTGG - Intergenic
1157310898 18:46552502-46552524 GAGGCTAGGAGGGCTAGGAGTGG + Intronic
1157886880 18:51377276-51377298 GAGGCTGGGAAGGGTAGTAGTGG + Intergenic
1158963354 18:62604143-62604165 GAGGCGGGGAGAGCAAGGAGAGG + Intergenic
1160659514 19:291555-291577 GAGGAGGGGAGGGCTAGGGGCGG + Intergenic
1160960526 19:1718768-1718790 GAGGCTGGGAGCGCTTGGAGTGG - Intergenic
1161671552 19:5614241-5614263 TAGGCTAGGCGGGCCAGGCGCGG - Intronic
1162038124 19:7953424-7953446 GAGGAGAGGAGGGGGAGGAGGGG - Intergenic
1162596308 19:11632192-11632214 GAGGCTAGGAAGGGTAGTGGAGG + Intergenic
1163223265 19:15937010-15937032 GATACAAGGAGGGCCAGGAGGGG - Intergenic
1163877034 19:19880412-19880434 AAGGCTGCGCGGGCTAGGAGTGG + Intronic
1164566360 19:29328819-29328841 GAGGCTGGCAGGGCTTGGATGGG + Intergenic
1164612975 19:29645623-29645645 GCGGCAAGGAGGGATTGGAGGGG + Intergenic
1165390260 19:35534580-35534602 AAGGCTGGGAGTGCTGGGAGAGG + Intronic
1165608963 19:37133959-37133981 GAGGACAGGATGGCTAGGACGGG - Intronic
1165985051 19:39761169-39761191 GAGGCTGGGAAGGATAGTAGAGG + Intergenic
1166161781 19:40959456-40959478 GAGGGAAGGAGGGGAAGGAGAGG - Intergenic
1167059556 19:47135325-47135347 GAGGCTAGGAAGGGTAGTGGGGG - Intronic
1167075007 19:47243254-47243276 GGGGCTGGGAGGGCGGGGAGGGG + Intergenic
1167436003 19:49479068-49479090 GAGGACAGGAGGGGAAGGAGTGG - Intronic
1167569821 19:50280178-50280200 GTGGCTGGGAGGACAAGGAGGGG - Intronic
1167694858 19:51009378-51009400 CAGGCTGGGAGGGCAGGGAGAGG + Intronic
1167762872 19:51460436-51460458 AAGGATAGGAGGCCCAGGAGGGG - Intergenic
1168471143 19:56642044-56642066 GAGACAAGGAGGGGGAGGAGGGG + Intergenic
925993281 2:9270715-9270737 GAGGCTGGGAAGGGTAGGTGGGG - Intronic
926292466 2:11541777-11541799 GGGGGTAGGAGGGCAACGAGGGG - Intronic
926768977 2:16351297-16351319 CAGGCCTGGAGGCCTAGGAGGGG + Intergenic
927341933 2:21992571-21992593 CAGGCCTGGAGGCCTAGGAGGGG - Intergenic
927361964 2:22246405-22246427 GAGGCTGGGAAGGGTAGTAGGGG + Intergenic
927812110 2:26185998-26186020 TAGGCTGGGAAGGCTAGGAAGGG + Intronic
928182743 2:29080920-29080942 GAGGCCAGGAGGGCTGAGGGAGG - Intergenic
929380012 2:41338046-41338068 GAGGGAAGGAGGGAGAGGAGAGG + Intergenic
930271980 2:49267815-49267837 GGGGCTTGGGGGGCTAGGGGAGG + Intergenic
930779052 2:55204922-55204944 GAGGCTATGAAGGGTAGTAGGGG + Intronic
930891820 2:56398803-56398825 GAGGCTGGGAAGGGTAGTAGGGG - Intergenic
931486032 2:62693014-62693036 GAGGCTGGGAAGGGTAGTAGGGG - Intronic
932574750 2:72956417-72956439 GAGGGGAGGAGGGCTGGGTGAGG + Intronic
932625514 2:73293162-73293184 GAGGTAAGGAGGGCGAGCAGGGG - Exonic
932682325 2:73836652-73836674 GAGGCTGGGAGGGAGAGCAGTGG + Intronic
933687894 2:85157856-85157878 GAGGGAAGGAGGGAGAGGAGGGG - Intronic
934088928 2:88534212-88534234 GAGGCTGGGAAGGGTAGGAGGGG - Intergenic
934870886 2:97864220-97864242 GAGGCTGGGAAGGATAGCAGCGG + Intronic
938816545 2:134910352-134910374 GATGCTTGGATGGCTATGAGTGG - Intergenic
938945647 2:136209617-136209639 GAGGAGTGGAGGGCTATGAGAGG + Intergenic
939086426 2:137724209-137724231 GAAGCTGGGAGGGGTAGTAGAGG + Intergenic
939935902 2:148293232-148293254 GAGGCTGGGAAGGGTAGTAGGGG + Intronic
940419187 2:153458523-153458545 CTGGCTAGGAAGGCTGGGAGAGG - Intergenic
940503201 2:154520550-154520572 GAGGCTGGGAGGGCTAGTTGGGG - Intergenic
940750634 2:157623592-157623614 GAGGCTGGGAAGGGTAGTAGGGG + Intronic
940990943 2:160095776-160095798 GAGGCTGGGAAGGGTAGTAGGGG + Intergenic
941113281 2:161441527-161441549 GAAGCTATGAGGGCCGGGAGTGG - Intronic
941134065 2:161691308-161691330 GAGGCTGGGAAGGGTAGGTGGGG + Intronic
941399650 2:165014979-165015001 GAGGGTAGGGGGGCAAAGAGGGG + Intergenic
942179950 2:173370876-173370898 GAGGCTGGCAGGGCTGGAAGGGG + Intergenic
942241005 2:173964323-173964345 GAGGCGAGGAGGGAGGGGAGAGG + Intronic
942524135 2:176835180-176835202 GAGGCTGGGAAGGGTAGTAGGGG + Intergenic
943545580 2:189272510-189272532 GAGGGGTGGAGGGCTAGGGGAGG + Intergenic
946125424 2:217558416-217558438 GAGGCTAGAAGGGTGAGGAGAGG - Intronic
946843218 2:223837684-223837706 GAGAGCAGGAGGGCGAGGAGCGG - Intronic
946855272 2:223944765-223944787 GGGGCGAGGTGGGCTGGGAGGGG + Intronic
947129422 2:226905800-226905822 AAGGCTGGGAGGGGTATGAGAGG + Intronic
948157149 2:235792736-235792758 GAGGCTAGGAGGCCCAGGCTGGG + Intronic
948764743 2:240213623-240213645 GGGGCTGGGGGGGCTTGGAGGGG - Intergenic
1169651656 20:7874908-7874930 GAGGCTGGGAGGGGTAGTAGGGG + Intergenic
1169787572 20:9376538-9376560 GAGTCCAGGAGGGATAGCAGAGG + Intronic
1170511168 20:17078326-17078348 GAGGCTGGGAGGGGTAGTTGGGG - Intergenic
1170996789 20:21369060-21369082 GAGGCTGGGAAGGGTAGTAGGGG - Intronic
1171860763 20:30400672-30400694 CAGGCTAGGAAGTCTAGGATTGG + Intergenic
1172248595 20:33463248-33463270 CAGGGTAGGGGGGCTTGGAGGGG - Intergenic
1172477231 20:35248117-35248139 GATGCTAGCAGGGCTGGGTGAGG + Intronic
1172617336 20:36298020-36298042 GAGTGTAGGAGGGGGAGGAGGGG - Intergenic
1173303352 20:41824597-41824619 GAGGATAGGAAGGGTAGTAGAGG - Intergenic
1174645409 20:52081057-52081079 GGGGCTAGGTGGGGTGGGAGAGG + Intronic
1175183878 20:57166925-57166947 GGGGCTGGGAGGGTTAGCAGTGG - Intergenic
1175471067 20:59228961-59228983 GAGGCTGGGAAGGGAAGGAGAGG - Intronic
1176077048 20:63253473-63253495 GAAGCTAGAAGGGCCAGAAGGGG - Intronic
1176281475 20:64316320-64316342 GAGGCGGGGGCGGCTAGGAGGGG - Intergenic
1176737738 21:10567165-10567187 GAGGCTAGGAATGGTAGTAGGGG + Intronic
1177009209 21:15711364-15711386 AAGGCTAGGAAGGCTGGAAGAGG - Intergenic
1177024934 21:15911383-15911405 GAGGGATGGAGGGCTGGGAGAGG - Intergenic
1177128550 21:17228029-17228051 GAGGTTAGGAAGGGCAGGAGGGG + Intergenic
1178224379 21:30699007-30699029 GAGGACATGAGGTCTAGGAGGGG - Intergenic
1178719775 21:34998203-34998225 GAAGCAAGAAGGGCTGGGAGAGG + Intronic
1179971419 21:44838199-44838221 GAGCCTAGGAGGGGTGGGCGGGG - Intergenic
1180829633 22:18897222-18897244 GACACTAGGACTGCTAGGAGGGG - Intergenic
1180972572 22:19823020-19823042 GAGGGCAGGAGGCCTGGGAGGGG + Intronic
1181507271 22:23368135-23368157 GAGGCTAGCATGGCTCAGAGTGG + Intergenic
1181848343 22:25731316-25731338 GAGGCTAGGAAGGGTAGTATGGG - Intergenic
1182671870 22:32002933-32002955 GAGGCCAGGAAGGGTAGCAGGGG - Intergenic
1183180663 22:36257733-36257755 GAGGAGAGGAGGGCTGGGAGAGG + Intronic
1183464385 22:37972363-37972385 GGGGCTAGAGTGGCTAGGAGAGG + Exonic
1183511720 22:38239343-38239365 GGCGTTAGGAGGGCGAGGAGGGG - Intronic
1183964619 22:41434352-41434374 GATGGGAGGAGGGCTAGAAGGGG + Exonic
1184241196 22:43212119-43212141 GAGGTTGGGAGGGTGAGGAGGGG - Intronic
1184300488 22:43555926-43555948 GTGGCCAGGTGAGCTAGGAGGGG + Intronic
1184669971 22:46007327-46007349 GAGCCTGGCAGCGCTAGGAGAGG + Intergenic
1184915459 22:47565802-47565824 GAGGCTTGAAGAGGTAGGAGAGG + Intergenic
1185065358 22:48629275-48629297 GAGGATGGGAGGCCTGGGAGAGG - Intronic
1185126153 22:49011905-49011927 GAGGATGGGAGGGATGGGAGAGG - Intergenic
1203279724 22_KI270734v1_random:122494-122516 GACACTAGGACTGCTAGGAGGGG - Intergenic
950119391 3:10471551-10471573 GAGGCTAGGAGTGGGAGGAGAGG + Intronic
950127397 3:10518434-10518456 GAGGTTAGAAGGGATAGGGGAGG + Intronic
950221472 3:11199647-11199669 GGTGCTGGGAGGACTAGGAGGGG - Intronic
950431251 3:12952485-12952507 GAGGCTAGAAGAGCCTGGAGAGG - Intronic
950733445 3:14983244-14983266 GAGGCTAGGAAGGGTAGTGGCGG - Intronic
952430416 3:33218509-33218531 GAGACTTGGTGGGCCAGGAGAGG + Intronic
952549118 3:34456026-34456048 GAGGCTAGGAAGAATAGTAGGGG - Intergenic
952946254 3:38479506-38479528 GAGGCAGGGAGGGCTAGGGGTGG - Intronic
953533517 3:43759106-43759128 CAGGGTAGGAGGGCCAGGGGAGG + Intergenic
953670599 3:44959010-44959032 GAGGATAGGAGGGCCAGGGGAGG - Intronic
955494341 3:59515980-59516002 GATGCTGGGAGGGCTGGGAGTGG - Intergenic
956237449 3:67090020-67090042 GAGGCTAGGAAGGGTAGTGGAGG + Intergenic
956325543 3:68048603-68048625 GAGGCTGGGAAGGCTAGTAGGGG - Intronic
956781872 3:72610169-72610191 TAGGATAGCAGGGCCAGGAGCGG + Intergenic
957954097 3:87161373-87161395 TAGGGTAGGGGGGCTAGAAGGGG - Intergenic
959640028 3:108622222-108622244 GAGGCTGGGAAGGGTAGGTGGGG + Intronic
960912058 3:122659026-122659048 GAGGCCAGGAGGGATATGGGAGG + Intergenic
960977065 3:123185831-123185853 GAGGCTGGGAAGGGTAGTAGAGG - Intronic
961029592 3:123590206-123590228 GAGGCCAGTATGACTAGGAGGGG - Intergenic
962259865 3:133895526-133895548 GAGAGTAGGAGGGCGAGGGGAGG + Exonic
962382678 3:134910229-134910251 GAGGAAGGGAGGGCAAGGAGGGG - Intronic
962418651 3:135207619-135207641 GTGTCTAGGAGGGCTTGCAGAGG + Intronic
963015697 3:140821911-140821933 GAGAGAAGGAAGGCTAGGAGGGG + Intergenic
963359595 3:144253808-144253830 GAGGCTGGGAAGGATAGTAGGGG - Intergenic
964208287 3:154199210-154199232 GAGGCTAGGAAGGGTAGTCGGGG - Intronic
964700055 3:159555916-159555938 GAGGGGTGGAGGGCTAGGGGAGG + Intronic
964756555 3:160094719-160094741 AAGGCCAGTAGGGCTGGGAGAGG - Intergenic
964943037 3:162185076-162185098 GAGACTAGGTGGGATGGGAGTGG - Intergenic
964982963 3:162709497-162709519 GAGGGTAGGAAGGGTAGCAGTGG - Intergenic
966010234 3:175066294-175066316 CAGGCTTGGAGGGTTAGGAAAGG - Intronic
966613239 3:181889057-181889079 GAGAGGAGGAGAGCTAGGAGAGG + Intergenic
966908517 3:184544601-184544623 GAGGGGAGGAGGAGTAGGAGGGG - Intronic
967814835 3:193789719-193789741 GAGGCTAGAAGGGGAAGGAAAGG + Intergenic
968528969 4:1080192-1080214 AAGGATGGCAGGGCTAGGAGGGG - Intronic
969454847 4:7295035-7295057 GAGGGGAGGAGGGAGAGGAGGGG - Intronic
969650624 4:8465787-8465809 GAGGCAAGGAGGGCTTGGCGAGG - Intronic
969912865 4:10461357-10461379 GAGGCTAGTGGGGCCACGAGCGG + Intergenic
970342699 4:15123115-15123137 GAGGCTGGGAAGGGTAGTAGGGG - Intergenic
971595975 4:28529385-28529407 GAGACTAGGAAGGGTAGCAGAGG - Intergenic
972183826 4:36503151-36503173 GAGACTAGGACGCCTAGGAGAGG - Intergenic
972462102 4:39314414-39314436 GAGGCTAGAAGTGCTAAGATTGG - Intronic
972762647 4:42122014-42122036 GAGGCTGGGTGGGCCGGGAGCGG + Intronic
972896146 4:43622197-43622219 GAGGCTAGGAGGGTGAGGACTGG + Intergenic
973117433 4:46478583-46478605 GAGGGTGGGCGGGCTAGGGGAGG + Intergenic
973916961 4:55643630-55643652 GAGGCTGGGAAGGCTAGTAGGGG - Intergenic
974403803 4:61439596-61439618 GGGGGTTGGAGGGCTAGGGGAGG - Intronic
974728922 4:65835981-65836003 GTGGGGAGGAGGGCTAGGGGAGG - Intergenic
975393942 4:73853477-73853499 CAGGCTGGGAGGGCCAGCAGCGG + Intronic
975513696 4:75221431-75221453 GAGGCTGGGAAGGGTAGTAGTGG + Intergenic
976158019 4:82168670-82168692 GAGGGGTGGAGGGCTAGGAGAGG + Intergenic
978400182 4:108322865-108322887 GAGGCTGGGAAGGATAGTAGAGG + Intergenic
978519516 4:109601391-109601413 GAGGCTGGGAGGGGTAACAGGGG - Intronic
978733919 4:112063641-112063663 GAGGCTAGGAAGAGTAGTAGGGG + Intergenic
978929820 4:114296463-114296485 GAGGCTTGGAGGGAGAGGCGTGG - Intergenic
979446087 4:120813805-120813827 GTTGCTATGAGGGCTAGGACAGG - Intronic
979892304 4:126113983-126114005 GAGGCTGGAAAGGCTAGTAGAGG - Intergenic
980252621 4:130337060-130337082 GAGGCAAGGAGTGCAACGAGTGG - Intergenic
980637539 4:135527346-135527368 GGGGCGTGGAGGGCTAGGGGAGG + Intergenic
980827383 4:138089065-138089087 GAGGTGAGGAGGGAGAGGAGCGG - Intergenic
981033979 4:140152105-140152127 GCGGCTGGGAGGGTTAAGAGGGG - Intronic
981547869 4:145913053-145913075 GAGGCTGGAAGGACTATGAGTGG + Intronic
981927517 4:150155959-150155981 GAAGCTAGGTGGGAGAGGAGTGG + Intronic
984902572 4:184598271-184598293 AAGGCTGGCAGGGCCAGGAGGGG - Intergenic
985159298 4:187027498-187027520 GAGGGTTGGAAGGCTGGGAGTGG + Intergenic
985688660 5:1295094-1295116 GGGGCTGGGAGGGCCCGGAGGGG + Intergenic
986928819 5:12794203-12794225 AAGGCTATCAGGGCTAAGAGTGG + Intergenic
986996032 5:13608339-13608361 GAGGCTAGGAAGGGTAGTTGGGG + Intergenic
987564554 5:19567073-19567095 GAGGCTAGGAAGGGTAGTGGTGG + Intronic
988671296 5:33384868-33384890 GAAATTTGGAGGGCTAGGAGTGG - Intergenic
989389292 5:40883365-40883387 GAGATTTGGAGGGCTAGGGGTGG + Intergenic
990155640 5:52874102-52874124 GAGGCTGGGAGGGCCAAGATAGG + Intronic
990540736 5:56770497-56770519 GAGGCCAGGAGTGTTAGGTGAGG + Intergenic
990648495 5:57870924-57870946 GAGGCTGGGAAGGTTAGTAGGGG - Intergenic
990724656 5:58740344-58740366 GAGGCTGGGATGGCTGGGTGGGG - Intronic
990903321 5:60777087-60777109 GAGGCTAGGAAGGGTACTAGGGG + Intronic
990919429 5:60945765-60945787 GGGGCTAGAAGGGCCAGGGGAGG + Intronic
990921117 5:60968855-60968877 GAGGCTAGGGAGGGTAGTAGAGG - Intronic
991219657 5:64198713-64198735 GAGGCTAAGAAGGGTAAGAGAGG + Intronic
992850515 5:80802718-80802740 GAGGCTGGGAAGGGTAGTAGGGG - Intronic
993287807 5:86022920-86022942 GAGGGTTGGGGAGCTAGGAGAGG - Intergenic
993747920 5:91624971-91624993 GAGGCTAGCAGGGCTGGAATGGG + Intergenic
994072962 5:95621411-95621433 GAGGCGCGGAGGACGAGGAGGGG + Exonic
997398018 5:133580203-133580225 GAGGCTGTGAGGGATGGGAGTGG - Intronic
997666392 5:135632823-135632845 TAGGATTGGAGGGCGAGGAGAGG + Intergenic
998983957 5:147734500-147734522 GAGGGTGGGGGGGCTAGGGGAGG + Intronic
999480223 5:151941286-151941308 GAGGTGAGCAGGGCTAGAAGAGG + Intergenic
1000433825 5:161183326-161183348 GAGGCTGGGAAGGGTAAGAGGGG + Intergenic
1000452326 5:161405154-161405176 GAGGCTAGGAAGGATGGCAGTGG - Intronic
1001282699 5:170398753-170398775 GAGGCTGGGAGGGATTGGGGTGG - Intronic
1001326046 5:170725509-170725531 GAGGCTGGGAAGGATAGTAGGGG + Intronic
1001449687 5:171815078-171815100 GAGTCTAGGAGGGTGAGGATGGG - Intergenic
1001527223 5:172437500-172437522 GAGGCTGGCAGGGCTGGGATTGG - Intronic
1001590306 5:172860241-172860263 GAGGGCAGGAGGGCGTGGAGAGG + Intronic
1001814097 5:174653391-174653413 GAGGCTGGGAAGGGTAGTAGGGG + Intergenic
1002010014 5:176271565-176271587 GAGGCTAGGAAGGGGAGTAGGGG + Intronic
1002216720 5:177640739-177640761 GAGGCTAGGAAGGGGAGTAGGGG - Intergenic
1002400564 5:178989499-178989521 GTGGCCAGGTGAGCTAGGAGTGG + Intronic
1002400580 5:178989575-178989597 GTGGCCAGGTGAGCTAGGAGTGG + Intronic
1002419591 5:179138683-179138705 GAGGACAGCAGGGGTAGGAGAGG + Intronic
1002636736 5:180612415-180612437 GAGCCTAGATGGGCTTGGAGGGG + Intronic
1003062564 6:2874961-2874983 GAAGCTGGGAGGGCTGGGATGGG - Intergenic
1003219753 6:4148745-4148767 GAGGCTGGGAAGGGTAGTAGGGG - Intergenic
1003708541 6:8562647-8562669 GAGGCTAGGAAGGGTAGTGGGGG + Intergenic
1004704807 6:18114645-18114667 GAGGCTGGGAAGGGTAGTAGGGG + Intergenic
1005156527 6:22813260-22813282 GAGGCTGGGAAGGGTAGGACGGG - Intergenic
1006026340 6:31149519-31149541 GAGGCTGGGAGGTCGAGGCGAGG - Intronic
1006903592 6:37518362-37518384 GTGCCCAGCAGGGCTAGGAGTGG - Intergenic
1007124467 6:39413705-39413727 GAGACAAGGAGGGAGAGGAGAGG + Intronic
1007236626 6:40395063-40395085 GAGGCCAGAGGGGTTAGGAGAGG + Intronic
1007412855 6:41674887-41674909 GGGGCTAGGTGGGGAAGGAGGGG - Intergenic
1007775408 6:44222088-44222110 GGGCAGAGGAGGGCTAGGAGAGG + Intronic
1007957261 6:45929324-45929346 GAGGGCAGGAGGGAGAGGAGTGG - Intronic
1008600093 6:53084845-53084867 GAGGCTAGGAAGTCAAAGAGAGG + Intronic
1009846346 6:69140480-69140502 GAAGCTGGGAGAGCTGGGAGAGG + Intronic
1010614773 6:77999335-77999357 GAGTCTAAGAGGACTAGGTGAGG + Intergenic
1010626777 6:78146300-78146322 GAGGCTGGGAGGGGTAGTCGGGG + Intergenic
1010839361 6:80629991-80630013 GAGGCTAGGAAGGGTAGTGGGGG + Intergenic
1011412454 6:87080078-87080100 GAGGGAAGGAGGGTCAGGAGAGG - Intergenic
1012883256 6:104816284-104816306 GAGGCCTGGAGGCCTAGGAGGGG + Intronic
1014186328 6:118438505-118438527 GAGGCTGGGAAGGGTAGTAGGGG - Intergenic
1014331356 6:120069200-120069222 GAGGCTAGGAAGGGTAGTTGCGG - Intergenic
1014846317 6:126281896-126281918 GAGGGTGGGGGGGCTAGGGGAGG - Intergenic
1015052497 6:128859062-128859084 GAGGCTTGGAAGGGTAGTAGGGG - Intergenic
1015882654 6:137884855-137884877 CGGGGTAGGGGGGCTAGGAGAGG - Intergenic
1016748612 6:147608635-147608657 GAGGCTGGGAAGGGTAGTAGGGG + Intronic
1017396691 6:154008761-154008783 GAGGCTGGGAAGGTTAGTAGGGG + Intergenic
1017812301 6:157992271-157992293 GAGGCTAGGAAGGGTAGCGGCGG - Intronic
1018602071 6:165555014-165555036 GAGGCTAGGAAGTGTAGTAGGGG + Intronic
1018806392 6:167264606-167264628 GAGGGGTGGAGGGCAAGGAGAGG + Intergenic
1019303811 7:322807-322829 GGGGCCAGGAGGGCAAGGCGGGG + Intergenic
1019310703 7:359313-359335 GAGGCTGGCAGGCCTAGAAGGGG + Intergenic
1019622278 7:1998444-1998466 GAGGCCAGGAGGGTTAGAAATGG - Intronic
1020225869 7:6279487-6279509 GAGGCTAGGAGGTCAAGGTCAGG + Intergenic
1022184073 7:27949843-27949865 GAGGCTAGCAGAGCTGTGAGAGG - Intronic
1022473584 7:30696139-30696161 GAGGCTGGGAAGGGTAGTAGGGG + Intronic
1022653019 7:32294175-32294197 GAGGCTTGAGGGGCTGGGAGTGG - Intronic
1023622024 7:42083191-42083213 GAGGCTAGGAAGGATAGTGGGGG - Intronic
1024234084 7:47384804-47384826 GGGTCTAGATGGGCTAGGAGAGG - Intronic
1024411816 7:49051861-49051883 GAGACTAGGAAGAGTAGGAGAGG + Intergenic
1024464151 7:49692546-49692568 GAGTTTAGAAGGGCTAGAAGAGG - Intergenic
1024956995 7:54932965-54932987 GAGGCTAGGAAGGGTAGTGGGGG + Intergenic
1025952359 7:66155409-66155431 GAGGCTAGGAAGGGTAGTGGGGG + Intergenic
1026408875 7:70098411-70098433 GGGGCTGGGAGTCCTAGGAGGGG + Intronic
1026548515 7:71346502-71346524 GAGGCAAGGTGGCCTTGGAGAGG + Intronic
1026849716 7:73717222-73717244 GAGGGAGGGAGGGCTGGGAGCGG + Intronic
1026878190 7:73891759-73891781 GAGGGGAGGAGGCCTAGGCGTGG - Intergenic
1026954123 7:74366114-74366136 GGGGCCAGGAGGTCAAGGAGGGG - Intronic
1028233358 7:88330803-88330825 GAGGATGGGAGGACTAGCAGAGG + Intergenic
1028503330 7:91543335-91543357 GAGGCTAGGAAGGGTAGTTGGGG + Intergenic
1028722445 7:94049035-94049057 GAGGCTAGGAAGGGTAGTGGAGG + Intergenic
1029262438 7:99312449-99312471 AAGACTAGGAGGGCAAGGAAAGG - Intergenic
1030266464 7:107627003-107627025 GAGGCTGGGAAGGGTAGTAGGGG - Intronic
1030270911 7:107667347-107667369 GAAGTTAGGAAGGCAAGGAGAGG + Intronic
1030482039 7:110116536-110116558 GAGGACAGGAGAGGTAGGAGAGG + Intergenic
1030872505 7:114774563-114774585 GAGGCTAGGAGGGGTAGTGGGGG + Intergenic
1031170860 7:118290701-118290723 CAGGCCTGGAGGCCTAGGAGGGG + Intergenic
1031272047 7:119663888-119663910 GAGGCTGGGAGGGGAAGTAGAGG + Intergenic
1032576885 7:133063925-133063947 GAGGCTAAGAGGGATGGGAGGGG - Intronic
1033722063 7:144071166-144071188 GAGGCTGGGAAGGGTAGCAGGGG - Intergenic
1033899907 7:146124097-146124119 GAGGGGTGGAGGGCTAGGGGAGG + Intronic
1034084151 7:148308717-148308739 GGGGGTGGGAGGGCTAGGGGAGG - Intronic
1034455362 7:151167316-151167338 GAGGCTAGCGGGGCGAGGGGCGG + Exonic
1035046107 7:155967584-155967606 GAGGCTGGGAAGGGTAGGGGAGG - Intergenic
1036528238 8:9555820-9555842 GATGCTAGGCGGGGTAGCAGGGG - Intergenic
1036694955 8:10968205-10968227 GAACCTGGGAGGCCTAGGAGCGG - Intronic
1037215947 8:16451037-16451059 GAGGGGTGGAGGGCTAGGGGAGG + Intronic
1037834828 8:22209705-22209727 GGGGCCAGGAGGGCGAGGGGTGG - Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038422025 8:27439552-27439574 GAGGCCAGTAGGGGTAGGAAGGG + Intronic
1039414655 8:37383603-37383625 CAGGCTAGGGGAGTTAGGAGAGG - Intergenic
1039838391 8:41276138-41276160 GAGGCTCTGTGGGGTAGGAGGGG - Intronic
1041366035 8:57105704-57105726 GAGGCTGGGAAGGGTAGTAGAGG + Intergenic
1041740282 8:61150528-61150550 GAGGGGAGGAGGGCTGGGGGTGG - Intronic
1042082001 8:65064477-65064499 GAGGCTAGGAAGGGTAGTTGGGG - Intergenic
1044219909 8:89658003-89658025 GAGGCTGAGAAGGGTAGGAGGGG + Intergenic
1044713672 8:95080949-95080971 GAGGCTAGGTGGGCTAACATGGG - Intronic
1045483809 8:102614374-102614396 GAGGGAAGGAGGGGAAGGAGAGG - Intergenic
1045530211 8:102977509-102977531 GGGGATAGGAGGGCTGGGATAGG + Intronic
1046166494 8:110443254-110443276 GAGGCTAGGAAGGGTAGTTGGGG - Intergenic
1046315561 8:112496789-112496811 GAGGCTGGGAAGGGTAGTAGAGG + Intronic
1047254077 8:123202424-123202446 GAGGATAAGAGGGCTCGGGGTGG - Intronic
1048492295 8:134905192-134905214 GAGGCTGGGAAGGGTAGTAGAGG + Intergenic
1048515737 8:135108979-135109001 GAAGCTAGGAAGGGTAGTAGGGG - Intergenic
1048516275 8:135114347-135114369 GAGATTTGGGGGGCTAGGAGTGG + Intergenic
1049665577 8:143841207-143841229 GAGGCTTGGAGGACGAGGAGGGG - Intergenic
1049707681 8:144050465-144050487 CAGGAGAGGAGGGCGAGGAGGGG + Intergenic
1051047760 9:12895539-12895561 GAGGCTGGGAAGGGTAGTAGGGG + Intergenic
1052506382 9:29359316-29359338 GAGGCTAGGAGGTCTGGGCTGGG + Intergenic
1052927972 9:34033458-34033480 GAGGCTAGGAAGGGTAGTGGGGG + Intronic
1054908513 9:70431871-70431893 GAGGCTAGGAAGGGTAAGGGTGG - Intergenic
1055029091 9:71754062-71754084 GAGGGGTGGAGGGCTGGGAGAGG + Intronic
1055388774 9:75795616-75795638 GAGGCTGGGAAGGGTAGTAGGGG - Intergenic
1056524804 9:87433113-87433135 GAGGGGAGGAGGGGGAGGAGAGG + Intergenic
1057832879 9:98420197-98420219 GGGGCAAGGAGGGCCAGGTGGGG - Intronic
1057905239 9:98977726-98977748 GAGGGTGGGAGGGTTAGGAAGGG + Intronic
1058248356 9:102659479-102659501 GAGGCTAGGAAGGGTAGTGGGGG + Intergenic
1059235908 9:112760581-112760603 GAGGGAAGTAGAGCTAGGAGAGG + Intronic
1059397980 9:114050727-114050749 GAGGGTAGGAGGGCTGGAAGAGG - Exonic
1060054654 9:120403146-120403168 CTAGCTAGGAGGGCTAGAAGAGG + Intronic
1060545194 9:124455130-124455152 GAGGCTGGCAGGGCTGGGTGGGG + Intronic
1060629394 9:125142993-125143015 GAGGCTAGGGGGGCTTGCGGGGG - Intronic
1060681217 9:125566950-125566972 GTGACTAGGAGGGATAGGGGCGG - Intronic
1060776746 9:126380238-126380260 GAGGAGAAGAAGGCTAGGAGAGG - Intronic
1060860706 9:126952457-126952479 GAGGCTTGGAGAGTTTGGAGAGG + Intronic
1060899879 9:127247926-127247948 GAGGCTGGGAAGGATAGTAGGGG - Intronic
1060942283 9:127549908-127549930 GAGGCTGGCGGGGCTGGGAGGGG - Intronic
1061219602 9:129242598-129242620 GAGGCAGGGAGGCCTAGGAGGGG + Intergenic
1061298227 9:129688689-129688711 GAGCCTAGCAGAGCTAGGACAGG + Intronic
1061398302 9:130355210-130355232 GGGGCCGGCAGGGCTAGGAGTGG + Intronic
1061440172 9:130597046-130597068 GAGGCTGGGAAGGGTAGTAGGGG - Intronic
1062142842 9:134969308-134969330 GAGGCTGGAAGGGCCAGGACAGG + Intergenic
1062298322 9:135847699-135847721 GGGGGTGGGAGGGCTAGGAGAGG + Intronic
1062607070 9:137353187-137353209 GAGGCCAGGAGGGCTGGTGGAGG - Intronic
1062607086 9:137353241-137353263 GAGGCCAGGAGGGCCAGTGGAGG - Intronic
1186008466 X:5102257-5102279 GAGGCTGGGAAGGGTAGTAGGGG - Intergenic
1187082499 X:16006116-16006138 GAGGCTGGGAGGGCTATAACTGG + Intergenic
1187487763 X:19720738-19720760 GAGGGAATGAGGGGTAGGAGAGG + Intronic
1188140750 X:26547717-26547739 GAGGCTGGGAAGGGTAGTAGAGG - Intergenic
1188664040 X:32796448-32796470 GAGGCTAGGAAGGGTAGGAAGGG + Intronic
1189964394 X:46357015-46357037 GAGGCTGGGAGGGGTAGTGGAGG - Intergenic
1190534080 X:51408401-51408423 AAGGCTTTCAGGGCTAGGAGTGG - Exonic
1190806846 X:53845978-53846000 GAGGCTGGGAAGGCTAGTGGTGG - Intergenic
1191040637 X:56075662-56075684 GAGGCTGGGAAGGGTAGGTGGGG - Intergenic
1192062869 X:67847823-67847845 GAGGCTGGGAAGGGTAGTAGGGG + Intergenic
1192128428 X:68524663-68524685 GAGGCTGGGGGGGCTAGGGGAGG - Intronic
1192137706 X:68619906-68619928 GAGGCTAGGAAGGGTAGTGGAGG - Intergenic
1192436264 X:71145422-71145444 GGGGCTACGAGGGCTTGGAATGG - Intronic
1192980437 X:76334137-76334159 GAGGCTGGGAAGTGTAGGAGGGG + Intergenic
1193112722 X:77745583-77745605 GAGGCTAGGACGGGTAGTGGGGG + Intronic
1193205242 X:78740061-78740083 TAGGCTCAGAGGCCTAGGAGCGG - Intergenic
1193489949 X:82136730-82136752 GAGGCTAGGAAGGCTAGTGAGGG + Intergenic
1193579183 X:83241846-83241868 GAGGCTGGGAAGGGTAGTAGGGG + Intergenic
1194925849 X:99822115-99822137 GAGGCTGGGAAGGGTAGTAGGGG + Intergenic
1195127416 X:101822294-101822316 GAGGCTAGGAGGTCTGGGCCAGG - Intergenic
1195244608 X:102983994-102984016 GAGGATAGGAGGGTTGGAAGGGG - Intergenic
1195934747 X:110114259-110114281 GAGGGGAGAGGGGCTAGGAGAGG - Intronic
1196254536 X:113500837-113500859 GAGGCTGGGAAGGTTAGCAGGGG - Intergenic
1196565039 X:117195396-117195418 GAGGCTAGGAGGGGTACTGGTGG + Intergenic
1197028094 X:121780085-121780107 GAGGCTGGGAAGGGTAGTAGGGG - Intergenic
1197117870 X:122854364-122854386 GAGGCTGGGAGGGCTAGTAAGGG + Intergenic
1197156815 X:123279202-123279224 GAGGATAGGGTGGTTAGGAGTGG + Intronic
1198547856 X:137712301-137712323 GAGGCTGGGAAGGATAGAAGTGG - Intergenic
1199599894 X:149535614-149535636 GAGGAGAGGAGGTCGAGGAGAGG - Intergenic
1199867419 X:151864717-151864739 GAGGCTGGGAAGGGTAGTAGGGG - Intergenic
1200059806 X:153479230-153479252 GAGGGAAGGAGAGCTGGGAGAGG - Intronic
1200092039 X:153640503-153640525 GACACCAGGAGGGCTGGGAGTGG + Intergenic
1200154418 X:153967824-153967846 GAGGAGAGGAGGGCTTGGTGTGG + Intronic
1200359160 X:155583798-155583820 GAGACTTGGAAGGGTAGGAGGGG + Intronic
1201146064 Y:11066384-11066406 GAGGGAAGGAGGGAGAGGAGGGG + Intergenic
1201421702 Y:13806590-13806612 GAGGCAAGGAGGGAAAGGAAAGG - Intergenic
1201946402 Y:19515166-19515188 GAGGCTGGGAGGTCTAGGCTGGG + Intergenic