ID: 1157310906

View in Genome Browser
Species Human (GRCh38)
Location 18:46552569-46552591
Sequence GAGAGCTCTGTGTGGTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157310906_1157310913 -3 Left 1157310906 18:46552569-46552591 CCCCTGGACCACACAGAGCTCTC 0: 1
1: 0
2: 1
3: 21
4: 191
Right 1157310913 18:46552589-46552611 CTCCCTTGGGGTGACTTCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 89
1157310906_1157310914 -2 Left 1157310906 18:46552569-46552591 CCCCTGGACCACACAGAGCTCTC 0: 1
1: 0
2: 1
3: 21
4: 191
Right 1157310914 18:46552590-46552612 TCCCTTGGGGTGACTTCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 61
1157310906_1157310917 6 Left 1157310906 18:46552569-46552591 CCCCTGGACCACACAGAGCTCTC 0: 1
1: 0
2: 1
3: 21
4: 191
Right 1157310917 18:46552598-46552620 GGTGACTTCGCAGGGAGCCAAGG 0: 1
1: 0
2: 0
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157310906 Original CRISPR GAGAGCTCTGTGTGGTCCAG GGG (reversed) Intronic
900215373 1:1478809-1478831 GGGAGCTGGGTGTGGTCCCGGGG + Intronic
900222634 1:1517476-1517498 GGGAGCTGGGTGTGGTCCCGGGG + Intronic
900471475 1:2857069-2857091 GGGAGGTCTGTGTGCTGCAGTGG + Intergenic
901195832 1:7439285-7439307 GATGGCTCAGTGTGGTCCAGGGG - Intronic
901731083 1:11280263-11280285 GAAAGGTCTGTGTGAGCCAGAGG + Intronic
902041711 1:13497243-13497265 GAGAGCTTTGTCTGGAGCAGCGG - Intronic
906546412 1:46622387-46622409 GAGAGCTGTGTCTGCTGCAGCGG + Intergenic
910112229 1:83694899-83694921 GAGAGCTCTGGCTGGTGCAAAGG - Intergenic
910529001 1:88214023-88214045 GTCAGCTATGTGTGGTCCTGGGG - Intergenic
912842007 1:113047176-113047198 GAGAGCTCGAAGTGGTCCTGAGG + Intergenic
913371511 1:118104860-118104882 CAGAGCTCTGAGTTGTTCAGTGG + Intronic
913604414 1:120451918-120451940 AAGAGCTCTCTGTGATACAGAGG + Intergenic
914426992 1:147586658-147586680 GAGAGCAGTGTGTGGTCCATAGG - Intronic
919058182 1:192596975-192596997 GAGAGCTCTGACTGATACAGTGG + Intergenic
920076714 1:203342488-203342510 GAGAACTCTGTGGGGACAAGAGG + Exonic
921217046 1:212946744-212946766 GAGAGCTCAGTTTTCTCCAGAGG + Intergenic
922226239 1:223648284-223648306 GACAGCTCCATGTGGCCCAGGGG - Intronic
924059253 1:240154759-240154781 GAGATCTCTGGTTGGTCCAAGGG - Intronic
1063109330 10:3020901-3020923 GAGAGTTCTGTATGGTGCATTGG + Intergenic
1064429880 10:15261763-15261785 GTGAGCTACGTGGGGTCCAGGGG + Intronic
1065523468 10:26594153-26594175 AGGAGCTCTGGGTCGTCCAGGGG - Intergenic
1065529402 10:26653274-26653296 GGGAGCTCTGGGTACTCCAGGGG - Intergenic
1065557481 10:26931343-26931365 GGGAGCTCTGGGTCGTCCAAGGG + Intergenic
1069247144 10:66220434-66220456 CAGAACTCTGTGTGGCCCCGTGG + Intronic
1070730131 10:78821452-78821474 GAGAGCTCTGTGATGTCTAGAGG - Intergenic
1070793578 10:79203964-79203986 GGGAGCTCTGGATGGCCCAGGGG - Intronic
1074532496 10:114306652-114306674 CAAAGTTCTCTGTGGTCCAGAGG - Intronic
1074716704 10:116226508-116226530 GTGAGCTCTGTATGGTTCAGAGG + Intronic
1076599025 10:131645361-131645383 GAGAGCTGGGTGTGCTACAGAGG - Intergenic
1076741197 10:132486584-132486606 GAGAGCTCTGTGTGGACTCGGGG - Intergenic
1077504743 11:2924770-2924792 GAGAGCTGTGTTTGCTCCAAAGG + Intronic
1078269387 11:9780856-9780878 GGGAGCTCCTTGTGCTCCAGGGG + Intronic
1078918774 11:15807178-15807200 AAGAGAGCTGTGTGGTCCAGAGG - Intergenic
1084007906 11:66332889-66332911 AAAAGCTCTATGTGCTCCAGGGG + Intronic
1084734688 11:71097059-71097081 GGGAGCTATGTGTGGTCCTTGGG + Intronic
1084792849 11:71485644-71485666 GAGAGGTGAGTGTGGCCCAGTGG + Exonic
1085508569 11:77073874-77073896 CAGAGCTCTGGGTGGCCTAGGGG + Intronic
1085529088 11:77181206-77181228 GAGGCCTCTGAGTGGTCCAGAGG + Intronic
1085708384 11:78807358-78807380 GACAGCTCTGTCTGATCCTGAGG + Intronic
1088530083 11:110798951-110798973 TAGGACTCTGTGAGGTCCAGTGG + Intergenic
1088796196 11:113268649-113268671 GATGGCTCTGTGTGCCCCAGGGG - Intronic
1089194574 11:116686781-116686803 GAGGGACCTGTGTGGTCCAGGGG + Intergenic
1090075828 11:123579505-123579527 GAGATCTCTGTGGGCTCCAGCGG + Intronic
1090930199 11:131290696-131290718 GAGGGCTCTGTGTGTTCCAGAGG + Intergenic
1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG + Exonic
1093904243 12:24671208-24671230 GAGAGCTATGTGGGACCCAGAGG + Intergenic
1094062228 12:26326503-26326525 GAGAGCTCTGTGGGTTCCTCTGG + Intergenic
1095887849 12:47207403-47207425 CAGAGCTGTGTGAGGCCCAGGGG + Intronic
1096847096 12:54413327-54413349 GAGGGGTCTGTGAGGGCCAGTGG + Intronic
1098806341 12:75024479-75024501 GAGATCTTAGTGTGATCCAGGGG + Intergenic
1101574062 12:105981129-105981151 GAGAGCCCTGTTTGCTCCAGAGG - Intergenic
1101672897 12:106893189-106893211 GAGAGCTCGGTGTGAGCCAATGG - Intergenic
1103763601 12:123267494-123267516 TGGAGCTCTGTGAGGACCAGCGG - Intronic
1103794647 12:123494871-123494893 CAGAGCTCTGTGTGGTCCCTGGG + Intronic
1104071692 12:125351384-125351406 GAGAGTTATGTGTGTTGCAGTGG + Intronic
1106315808 13:28592212-28592234 GAGAGCTCCATGTGTTCAAGCGG - Intergenic
1113469715 13:110535747-110535769 GAGAGCATGGTGTGGTCCAGTGG - Intronic
1114459469 14:22877409-22877431 GACTGCTGTGTGGGGTCCAGGGG - Exonic
1114886498 14:26858433-26858455 GAGGGCTCTGTGTGACTCAGTGG - Intergenic
1118915736 14:70102081-70102103 GAGATCTCTGTTGGGTCCTGTGG - Intronic
1120476632 14:84997224-84997246 CAGTGCTGTGTGTGGTACAGAGG - Intergenic
1120634879 14:86939257-86939279 GAGGGCTCTGTGTGTACCAGAGG + Intergenic
1121066339 14:90969991-90970013 GAGAGATTTGGGTGGTCCAGAGG - Intronic
1121489249 14:94346161-94346183 GAAAGTCCTGTGTGGTGCAGGGG - Intergenic
1121489260 14:94346217-94346239 GAAAGTCCTGTGTGGTTCAGGGG - Intergenic
1121489271 14:94346273-94346295 GACAGTCCTGTGTGGTGCAGGGG - Intergenic
1121489282 14:94346329-94346351 GACAGTCCTGTGTGGTGCAGGGG - Intergenic
1121489293 14:94346385-94346407 GACAGTCCTGTGTGGTGCAGGGG - Intergenic
1121489315 14:94346497-94346519 GAAAGTCCTGTGTGGTTCAGGGG - Intergenic
1121489326 14:94346553-94346575 GAAAGTCCTGTGTGGTTCAGGGG - Intergenic
1122331036 14:100913298-100913320 GAGAGCTATGCTTGGGCCAGTGG + Intergenic
1122480405 14:102043494-102043516 GAGGGCTCTGTTTGGTCTTGGGG - Intronic
1122813005 14:104298205-104298227 AAGAGGTCTGTGTGGACCACGGG + Intergenic
1122919926 14:104875853-104875875 GAGAGTTGTGTGTGTTCCTGTGG + Intronic
1128266167 15:66268372-66268394 GAGAGCCCTGTGTCCTCTAGAGG - Intergenic
1131312333 15:91302361-91302383 GAGAGATCTGGGGGGTGCAGAGG + Intergenic
1132350657 15:101137959-101137981 GAGGGTTCTGAGAGGTCCAGAGG + Intergenic
1132553311 16:562032-562054 GAGGGCTCTGTGTGAGCCTGTGG + Intronic
1133293226 16:4736448-4736470 GGGAGCTCTGTGGGGTACACAGG - Exonic
1134843027 16:17416508-17416530 GAGGGGACTGTGGGGTCCAGTGG + Intronic
1138461294 16:57149464-57149486 CAGAGCTCTGTGCAGTCCTGCGG - Intergenic
1139120253 16:64007660-64007682 GACTGCTCTGTGTGGTGCTGGGG - Intergenic
1139297656 16:65917288-65917310 AAAAGCTCTGTGGGGTGCAGAGG + Intergenic
1145236363 17:21210951-21210973 GAGGGCTCTGGGAGGTTCAGGGG + Intronic
1150129062 17:62656981-62657003 GAAAGCTTTATGTGTTCCAGGGG + Intronic
1150503878 17:65678626-65678648 CAGAGATCTGTGTGCTCCTGCGG + Intronic
1152277012 17:79363810-79363832 GAGAGTTCTGAGTGGGGCAGGGG - Intronic
1152853452 17:82650197-82650219 GAGACCTAAGTGCGGTCCAGGGG + Intergenic
1152936960 17:83144704-83144726 CAGAACTCTGTGGGGGCCAGAGG + Intergenic
1155380130 18:25212018-25212040 GAAATCTCTGTGTGGTTCTGTGG + Intronic
1155539274 18:26850245-26850267 GAGAACTTTGTGTGATTCAGGGG + Intergenic
1156249579 18:35339798-35339820 CAGAACTCTGTGTGGGCTAGAGG - Intronic
1156828248 18:41459262-41459284 AAGATCTCAGTGTGGTACAGAGG + Intergenic
1157310906 18:46552569-46552591 GAGAGCTCTGTGTGGTCCAGGGG - Intronic
1160262013 18:77302989-77303011 GAGAGCCATGTGGGGTCCAAGGG + Intergenic
1160264650 18:77330127-77330149 GAGACCTGTTTGTGGTGCAGAGG - Intergenic
1161478938 19:4501175-4501197 GAGAGATCTGGGTGGGACAGAGG - Exonic
1163031310 19:14545955-14545977 GGGGGCTCTATGTGGCCCAGAGG - Intronic
1164188297 19:22892629-22892651 AAGAGTTCTGTGTGGTACTGTGG - Intergenic
1165358297 19:35317731-35317753 GGGAGCTCTGTGGGTTCCTGGGG + Intergenic
1168209004 19:54875327-54875349 CAGTGCTCTGTCTGGGCCAGAGG + Exonic
925185933 2:1846473-1846495 GAGAGCTCTGTGTTCTCTGGGGG + Intronic
926694151 2:15758924-15758946 GGGAGCTCAGTGTGGCCAAGTGG + Intergenic
928734756 2:34275123-34275145 GAGAGATATGTGTGCTCTAGAGG - Intergenic
928833735 2:35518891-35518913 GAGATGTCTGTTTGGTCCACTGG + Intergenic
930231167 2:48845199-48845221 TAGCCCTGTGTGTGGTCCAGAGG + Intergenic
931349663 2:61475920-61475942 GAGATCTCTGTGGGGTGCAGTGG - Intergenic
932279176 2:70474696-70474718 AAGAGCACTGTGTAGCCCAGAGG - Intronic
932407282 2:71521942-71521964 GAGAGCTCTGGGAGCTCCTGTGG + Intronic
933853696 2:86393265-86393287 GGCAGCTCTCTGTGGTCTAGTGG - Intergenic
935291123 2:101611896-101611918 GAGAACCTTGAGTGGTCCAGCGG + Intergenic
937084129 2:119159211-119159233 GAGAGTCCCGTGAGGTCCAGCGG + Intergenic
937335555 2:121060099-121060121 GACAGCTCTGGGAGGTGCAGTGG + Intergenic
937422447 2:121769367-121769389 GCGAGCTCTATGTGTTCCATGGG + Intergenic
945921872 2:215763256-215763278 GAGAGCTCTCTGGGGTTCTGGGG + Intergenic
946178250 2:217935060-217935082 GAGAGGTCTGTGTAGTGCCGCGG - Intronic
946448169 2:219757553-219757575 CAGAGGGCTGTGGGGTCCAGGGG - Intergenic
1169193918 20:3673480-3673502 GGGAGCTCCGAGTGGTCCTGGGG + Exonic
1169355938 20:4905291-4905313 GAGGGGGCTGTGTGGTCAAGAGG + Intronic
1171393703 20:24817522-24817544 GGGTTCTCTGGGTGGTCCAGCGG - Intergenic
1172115135 20:32569211-32569233 CAGAGCTCAGTGACGTCCAGGGG + Intronic
1173629439 20:44500253-44500275 GAGACCTTTGTGAGTTCCAGTGG + Exonic
1174198368 20:48789403-48789425 GAGAGCTCAGGATGGGCCAGTGG + Intronic
1174664612 20:52246345-52246367 GAGAGCTCTGGGTGGTGTTGGGG - Intergenic
1175639264 20:60613892-60613914 GAGCCCTCTTTCTGGTCCAGAGG + Intergenic
1176027013 20:62990923-62990945 GAGACCCTTGTGTGGTCCTGTGG - Intergenic
1176046287 20:63094462-63094484 GGGGGCTCTGGGTGGCCCAGGGG + Intergenic
1176951697 21:15055113-15055135 GGGGGCACTGTGTGGACCAGTGG - Intronic
1178922721 21:36748910-36748932 TACAGATCTGTGTGGGCCAGAGG - Exonic
1179429770 21:41312873-41312895 CAGAGGCCTGTGTTGTCCAGTGG + Intronic
1179594045 21:42430498-42430520 GAGAGAGCTGTGTGGCCAAGAGG + Intronic
1180622478 22:17171480-17171502 GGGAGCTCTGTGCCGTCCCGCGG + Intergenic
1180905817 22:19410409-19410431 GAGAGCGGTAGGTGGTCCAGTGG - Intronic
1180907730 22:19426665-19426687 AAGAGTTCTGTGGGGACCAGAGG - Intronic
1180939078 22:19645099-19645121 CAGAGCTCTGTGCGGTGGAGAGG - Intergenic
1181037859 22:20178524-20178546 GTGACCTCTGGGTGGCCCAGGGG + Intergenic
1181058520 22:20271001-20271023 GACAGGTCTGTGTGGCCCTGAGG - Intronic
1182048618 22:27296500-27296522 GAGAGCTCTATGTGTTTCAAAGG + Intergenic
1183337818 22:37260652-37260674 TCCAGCTCTGGGTGGTCCAGGGG + Intergenic
1183647520 22:39134962-39134984 GAGTGCTCTGTGGGGCCCAGAGG - Intronic
1184071444 22:42150019-42150041 AAGAGCTCTATGCGGGCCAGGGG + Intergenic
1184241222 22:43212210-43212232 GAGAGCTTTCTGAGCTCCAGGGG - Intronic
1184649350 22:45912573-45912595 GAGGGGCCTGTGGGGTCCAGGGG + Intergenic
1185128977 22:49026855-49026877 GAGGACTCTGTGAGGTCCACAGG + Intergenic
950125573 3:10507813-10507835 GGAAGCTCTGTGTAGTTCAGGGG + Intronic
951456317 3:22896192-22896214 AAGAGCTGTGTGTGGACCAGGGG - Intergenic
952400538 3:32959390-32959412 GAGAGCACTGTGTGGTCAGGGGG + Intergenic
952938098 3:38416847-38416869 AAGAGCTCTTTGTTGTACAGGGG - Intronic
954612291 3:51951972-51951994 GAGAGCTCGGTGGGGCCAAGTGG - Intergenic
955962276 3:64352704-64352726 GAGAGCTCTGTGGGGTTCTAAGG + Intronic
958023990 3:88028688-88028710 CAGAACTCTGTGTGGCCCTGCGG - Intergenic
960358215 3:116679022-116679044 CAGAGCTCTGTGAGGCCCTGCGG - Intronic
961737252 3:129010141-129010163 GAGACCCCTAAGTGGTCCAGTGG + Intronic
969220208 4:5754244-5754266 GGGAGCAATGTGTGGCCCAGAGG + Intronic
970399578 4:15704371-15704393 GAGAGGTGTGTGTGTTCTAGAGG + Intronic
971405902 4:26320754-26320776 GAGCCCTCCGTGTGGTCCATGGG - Exonic
974083241 4:57233978-57234000 TAGAGGCCTGTGTGCTCCAGTGG - Intergenic
975083449 4:70308290-70308312 GAGGGCTCTGTTTGTTCCATTGG - Intergenic
976877860 4:89877816-89877838 GAGAGCACTGTGTGGCCATGAGG - Intergenic
978394042 4:108258863-108258885 GGGAGGACTGTGTGGACCAGTGG + Intergenic
980813136 4:137910009-137910031 GAATCCTCTGTGTGATCCAGAGG + Intergenic
982271644 4:153595857-153595879 GAGATCTTTGGGTTGTCCAGTGG + Intronic
984172686 4:176379840-176379862 GGGAGCTCTGTGTGTTCCCTGGG + Intergenic
984374340 4:178908461-178908483 GAGAACTTTGTGTGATCCTGTGG + Intergenic
985318114 4:188680143-188680165 CAGTACACTGTGTGGTCCAGAGG + Intergenic
985699699 5:1363211-1363233 GTGAGCGCTCTGTGGACCAGTGG + Intergenic
986370909 5:7079134-7079156 GGGAGCTTTATGTGGCCCAGTGG - Intergenic
986693171 5:10330706-10330728 GAGAGCTCTGGGTGTGACAGAGG + Intergenic
986819726 5:11452517-11452539 GAGAGCTCTGTGTGTTTTAAAGG - Intronic
986826899 5:11532006-11532028 GACAGCTGAGTGTTGTCCAGAGG - Intronic
988496134 5:31747781-31747803 GCTAGCTCTCTGAGGTCCAGTGG - Intronic
989124499 5:38038468-38038490 GACTGCTCTGTGTGATCCCGTGG + Intergenic
990640326 5:57776310-57776332 GATAGCTCTGTGATGTCCAGAGG - Intergenic
992522503 5:77569469-77569491 GAGAGCTCTGGGTGGTTGATAGG - Intronic
999991965 5:157058139-157058161 GAGAGCTCTGTGCCTTCCAAAGG + Exonic
1001784385 5:174399470-174399492 GAGAGCCATGTATGGTCAAGAGG + Intergenic
1002201831 5:177533113-177533135 GATAGCCCTGAGTGTTCCAGAGG - Intronic
1005617927 6:27593296-27593318 AAGGGCACTGTGTGGTCCTGTGG + Intergenic
1013482290 6:110563176-110563198 GAGAGCTCCATGTTGGCCAGAGG + Intergenic
1014748175 6:125224400-125224422 GAGAGCACTGTGTGTTCTTGGGG - Intronic
1015681996 6:135818578-135818600 GAGCCTTCTGTGTGGTCTAGTGG + Intergenic
1019257803 7:62933-62955 GAAAGCTGTCTCTGGTCCAGCGG + Intergenic
1019666470 7:2254477-2254499 GAGTGGCCTGTGGGGTCCAGTGG - Exonic
1020279078 7:6641227-6641249 CAGTGCTCTGTGTGGCCAAGTGG + Intronic
1023615813 7:42018079-42018101 GTGAGGGCTGTGTGGTCCACCGG - Intronic
1024414648 7:49091352-49091374 GAGATCTCTGTGAGTTCAAGAGG + Intergenic
1026477974 7:70753202-70753224 GAGAGCTGTGTGGAGTCCAGTGG - Intronic
1030963281 7:115954109-115954131 GAGGGCTCTATTTGTTCCAGAGG + Intronic
1034539295 7:151745909-151745931 AAGAGCTCTGAGGGCTCCAGCGG + Intronic
1034708516 7:153170248-153170270 GAGACCTTTGTGTGTTCCACTGG - Intergenic
1036812488 8:11877084-11877106 TAGGGCTCTGTGTGGGCAAGAGG + Intergenic
1039805556 8:40994600-40994622 GAGAACCCTGTGAGGTCAAGTGG + Intergenic
1040481753 8:47833184-47833206 GAGAACTGTGTGTGGGCCACAGG + Intronic
1042225016 8:66508441-66508463 GAGAGGTCAGTGTGGTCTGGAGG - Intronic
1048589802 8:135810944-135810966 GAGAGCTCTGTGCAGCACAGGGG - Intergenic
1050588059 9:7133779-7133801 GAGAGATCTGGGTATTCCAGAGG + Intergenic
1050758139 9:9033397-9033419 GAAAGCTCTGAGTGGAGCAGCGG - Intronic
1051559927 9:18429329-18429351 AATAGCTCTGTGTGGTTAAGGGG + Intergenic
1051586974 9:18736979-18737001 GAGAGTTCTATGTGGACAAGTGG - Intronic
1052988383 9:34504050-34504072 GGATGCTCTGTGTGGTCCTGAGG + Intronic
1053449080 9:38178469-38178491 GAGAGCTCAAACTGGTCCAGTGG - Intergenic
1053452511 9:38204752-38204774 CAGGGCTCTATGTGGTTCAGAGG - Intergenic
1057725630 9:97566051-97566073 AAGAGCTCTATGTGGTACAGTGG + Intronic
1060506036 9:124199093-124199115 GAAAGGTCTGTGTGGAACAGAGG - Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1062050453 9:134444236-134444258 GAGACCCCTGTGTGGGTCAGTGG + Intergenic
1062198801 9:135289756-135289778 GAGGCCTCTGTGTTGGCCAGGGG + Intergenic
1189132845 X:38518134-38518156 GAGTGTTCTGTGGGGTCCTGGGG + Intronic
1195703015 X:107718994-107719016 GAAAACTCTATGTGGTGCAGAGG - Intronic
1195858808 X:109358744-109358766 CAAAACTCTGTGTGGTCCTGTGG - Intergenic
1197712823 X:129684159-129684181 GAGAGCACTGTATGGTCCTTGGG - Intergenic
1199584225 X:149396306-149396328 GAGAGGGATGTGTGGTACAGAGG - Intergenic
1200206175 X:154317887-154317909 AGGAGCTCTGTGTGGGCCTGGGG + Intronic
1202102979 Y:21329962-21329984 GGGACCTCTGTGTGGACAAGAGG - Intergenic