ID: 1157312990

View in Genome Browser
Species Human (GRCh38)
Location 18:46566261-46566283
Sequence CTGGATCTCCACCACCTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157312988_1157312990 -10 Left 1157312988 18:46566248-46566270 CCTCCATACATTTCTGGATCTCC 0: 1
1: 0
2: 3
3: 14
4: 196
Right 1157312990 18:46566261-46566283 CTGGATCTCCACCACCTCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1157312983_1157312990 3 Left 1157312983 18:46566235-46566257 CCCACCACAGCCTCCTCCATACA 0: 1
1: 0
2: 1
3: 56
4: 725
Right 1157312990 18:46566261-46566283 CTGGATCTCCACCACCTCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1157312982_1157312990 24 Left 1157312982 18:46566214-46566236 CCATGGGAAACAATGGGTGGTCC 0: 1
1: 0
2: 2
3: 14
4: 195
Right 1157312990 18:46566261-46566283 CTGGATCTCCACCACCTCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1157312987_1157312990 -7 Left 1157312987 18:46566245-46566267 CCTCCTCCATACATTTCTGGATC 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1157312990 18:46566261-46566283 CTGGATCTCCACCACCTCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1157312984_1157312990 2 Left 1157312984 18:46566236-46566258 CCACCACAGCCTCCTCCATACAT 0: 1
1: 0
2: 4
3: 50
4: 627
Right 1157312990 18:46566261-46566283 CTGGATCTCCACCACCTCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1157312985_1157312990 -1 Left 1157312985 18:46566239-46566261 CCACAGCCTCCTCCATACATTTC 0: 1
1: 0
2: 3
3: 35
4: 386
Right 1157312990 18:46566261-46566283 CTGGATCTCCACCACCTCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1157312981_1157312990 25 Left 1157312981 18:46566213-46566235 CCCATGGGAAACAATGGGTGGTC 0: 1
1: 0
2: 0
3: 19
4: 103
Right 1157312990 18:46566261-46566283 CTGGATCTCCACCACCTCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1157312980_1157312990 26 Left 1157312980 18:46566212-46566234 CCCCATGGGAAACAATGGGTGGT 0: 1
1: 0
2: 1
3: 7
4: 142
Right 1157312990 18:46566261-46566283 CTGGATCTCCACCACCTCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1157312978_1157312990 27 Left 1157312978 18:46566211-46566233 CCCCCATGGGAAACAATGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1157312990 18:46566261-46566283 CTGGATCTCCACCACCTCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157312990 Original CRISPR CTGGATCTCCACCACCTCGC TGG Intronic
901789535 1:11647120-11647142 CTGCATCTCCACCACTGCACTGG + Intergenic
902827644 1:18987946-18987968 CTGGGCCACCACCACCTCCCAGG - Intergenic
904322546 1:29707139-29707161 CGGGACCTCCACCACCTCTAGGG + Intergenic
904746693 1:32715852-32715874 CTGGATCTCCCCCAGCAGGCTGG + Intergenic
905017905 1:34790202-34790224 TTATATCTCCACCACCTAGCAGG - Intronic
905971393 1:42144990-42145012 CTGGATTCCCACCACCTCCTCGG + Intergenic
906059195 1:42937260-42937282 CTGCACCTCCACCACCGTGCTGG - Intronic
906500914 1:46341374-46341396 CTGGGTCTCCGCCGCCTTGCAGG + Intronic
906991746 1:50746830-50746852 CTGGGTCTCACCCACCTCGTAGG - Intronic
907643804 1:56220241-56220263 CTCGACCTCCACCTCCCCGCAGG + Intergenic
909764355 1:79336985-79337007 CTGGATCTCCAAAACGTCACAGG - Intergenic
910968504 1:92831469-92831491 CTGACTCTCCAGCACCTAGCAGG - Intergenic
911743270 1:101410979-101411001 CTGGATTTCCCCCACTTCCCTGG + Intergenic
913058961 1:115187408-115187430 CTTGACCACCACCACCTCTCTGG + Intergenic
917797869 1:178544701-178544723 CTGGATCCCCAGCACCTGGAAGG + Intronic
922350123 1:224728398-224728420 GTGAATCTCAACCACCTGGCAGG - Intronic
922799890 1:228360373-228360395 CTGGATCACCGAGACCTCGCAGG - Intronic
1062934479 10:1375517-1375539 CTGGATGCCCACAACCTCACAGG - Intronic
1063375627 10:5552693-5552715 CTGCATCTCCACCACCCGCCAGG + Intergenic
1066549869 10:36544609-36544631 CTGGAGCTCCACCAGTTCACAGG + Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067768953 10:49109871-49109893 CTGCATCTCGCCCACCTGGCAGG + Intronic
1073501782 10:103945885-103945907 CTGGAGCTCATCCACCTCCCAGG - Intergenic
1074263838 10:111881494-111881516 ATGGATTTTCAGCACCTCGCTGG + Intergenic
1075485704 10:122820518-122820540 CTGGATTTCCACCCACTCGCTGG + Intergenic
1078027795 11:7714719-7714741 CTTGTTCTCCACAACCTCACCGG + Intergenic
1079244033 11:18740331-18740353 CTGTACCTCCATCACCTGGCTGG + Intronic
1079827187 11:25211923-25211945 CTGGCTTTCCACCACTTCCCTGG - Intergenic
1080868307 11:36214399-36214421 CTAGAGATCCACCAACTCGCAGG - Intronic
1082848476 11:57744779-57744801 CAGGATCTCCTCCAGCTCACTGG + Exonic
1084221575 11:67683750-67683772 CTTGGTCTCCACAACCTCGCTGG + Intergenic
1085255428 11:75169965-75169987 GTTTATCTCCACCATCTCGCTGG - Intronic
1088410530 11:109529386-109529408 CTGTTTCTCCACAACCTCTCCGG - Intergenic
1091840951 12:3620132-3620154 CCGGGTCTCCACCTCCTCCCTGG + Intronic
1092090649 12:5800992-5801014 CTGGTTCTCCTCCACATCACTGG - Intronic
1093564405 12:20585255-20585277 CTGGATCTCTAACAACTCCCTGG - Intronic
1096424535 12:51490008-51490030 CTGTATTTCCAGCACCTGGCAGG - Intronic
1101593305 12:106140941-106140963 GTGGATTTCTACCACATCGCAGG - Intergenic
1102678597 12:114674734-114674756 CAAGATCTCCACCACCACGTCGG - Exonic
1103961258 12:124610472-124610494 CTGAATCTGCACAACCTCCCAGG - Intergenic
1110567294 13:76969090-76969112 CTTTTTCTCCACAACCTCGCTGG + Intergenic
1113615094 13:111674970-111674992 CAGCATATCCACCACCTGGCAGG + Intergenic
1113620561 13:111759883-111759905 CAGCATATCCACCACCTGGCAGG + Intergenic
1113672831 13:112186508-112186530 CTGGAGCTCCACCATCTCTGTGG - Intergenic
1114992083 14:28299472-28299494 CTGCTTCTCCAGCACCTCACAGG - Intergenic
1120862402 14:89266582-89266604 CTCTATCTCCAGCACCTTGCAGG - Intronic
1122179747 14:99946553-99946575 CTGGATCTTCCCTACCTTGCTGG + Intergenic
1122933184 14:104944129-104944151 CTGGACGTCCACCTCCACGCTGG + Exonic
1122933302 14:104944624-104944646 CTGGACATCCACCTCCACGCTGG + Exonic
1122933422 14:104945119-104945141 CTGGACGTCCACCTCCACGCTGG + Exonic
1124179259 15:27457243-27457265 CTTTCTCTCCACCACCCCGCCGG - Intronic
1126674222 15:51145612-51145634 ATGGTTCACCACCACCTCTCTGG + Intergenic
1132085862 15:98907828-98907850 TTGGTCCTCCACCACCTCACTGG + Intronic
1133757891 16:8776349-8776371 CCGGATCTTCAACACCTGGCTGG + Exonic
1134394643 16:13851927-13851949 CTGGAACTCCTCCGCCTCCCGGG - Intergenic
1136613167 16:31379643-31379665 CTGCGTCTCCACCACCTGCCTGG - Exonic
1139534173 16:67561818-67561840 CTGGTTTTCCGCCACCTCTCCGG + Intergenic
1142806430 17:2373383-2373405 CTGCCTCACCACCACCTCGCAGG - Exonic
1142910887 17:3089807-3089829 CTGGCTTTCCACCACTTCCCTGG - Intergenic
1143028870 17:3956293-3956315 CTGGTTCTCCCCCACCTTGTGGG + Intronic
1144438447 17:15261403-15261425 CTGGCTCTGCACCACCTCTCCGG - Intronic
1145887858 17:28395496-28395518 CTCAATCTCCAGCACCTCTCTGG + Exonic
1146822930 17:35999034-35999056 CTGGACCACCACCACCTGTCTGG + Intronic
1146825051 17:36014505-36014527 CTGGACCACCACCACCTGTCTGG + Intronic
1149062305 17:52437374-52437396 CTGGTTCTTCCCCACCTCCCTGG + Intergenic
1151960375 17:77402533-77402555 CTGGATCTCCACCCTCTTGGGGG - Exonic
1152408050 17:80108564-80108586 CATGTTCTCCACCACCTGGCGGG - Intergenic
1152783364 17:82236191-82236213 CTGGATCTCCTCCATCCTGCTGG + Exonic
1156037035 18:32776079-32776101 CTGGATCTCTGCCACCTTGAAGG - Intergenic
1156093501 18:33500169-33500191 CTTAATCTCCTCCACCTGGCAGG - Intergenic
1157312990 18:46566261-46566283 CTGGATCTCCACCACCTCGCTGG + Intronic
1158650994 18:59285645-59285667 CTGCTTCTCCACCACCGTGCAGG + Intronic
1161435069 19:4258234-4258256 CCGGTTCTCCAGCACCTGGCGGG - Exonic
1161815346 19:6496280-6496302 CTGTCTCTCCACCACCTGGAGGG + Intronic
1163234512 19:16022892-16022914 CTGGCTCACCCCCACCTGGCAGG + Intergenic
1166053582 19:40275331-40275353 CTGCATCGCCACCACCTCCCTGG + Intronic
1167445892 19:49537308-49537330 CTGGTTCTCCAGCATCTTGCCGG + Intronic
1167567625 19:50266971-50266993 CTGGAGCTCCCCAACTTCGCGGG - Exonic
1168652098 19:58097954-58097976 CTGGATCTCAGCCACCTCCGGGG + Intronic
926939199 2:18117211-18117233 CGTGATCTCAACCACCTCCCTGG - Intronic
927499276 2:23571442-23571464 CCAGGTATCCACCACCTCGCAGG + Intronic
929597899 2:43187554-43187576 CTGAATCTCCAACACCTTCCAGG - Intergenic
932621433 2:73266664-73266686 GTCGATCTGCACCACCTCCCTGG + Exonic
936237663 2:110757534-110757556 CTCGTTCTCCGCAACCTCGCCGG + Intronic
945971307 2:216234327-216234349 CTGCATCTCCACATCCTCTCTGG - Intergenic
948023993 2:234762091-234762113 CTGCATCTCCACCAGCTCCTGGG + Intergenic
948807428 2:240459072-240459094 CAGGTTCTCCTCCATCTCGCTGG - Exonic
1170026180 20:11891323-11891345 CTGGACCTCCGCCACCTCCGGGG - Intronic
1171296141 20:24018866-24018888 TTGGATCTGCACCACCTCCAGGG - Intergenic
1180051881 21:45335271-45335293 CTGGATCTGTGCCCCCTCGCCGG + Intergenic
1180051926 21:45335384-45335406 CTGGATCTGTGCCCCCTCGCTGG + Intergenic
1183404716 22:37624800-37624822 CTGGCCCTCCGCCACCTCCCTGG - Intronic
1185226883 22:49658279-49658301 CTGCACCTCCTCCACCTCACTGG + Intergenic
1185345906 22:50310539-50310561 CTCGCTCTCCACCACCTGGCTGG + Exonic
953194611 3:40720762-40720784 CTCCATCTCCGCCACCTCTCTGG - Intergenic
953198200 3:40753823-40753845 CTGGATGTCCACTTCCTGGCAGG + Intergenic
961373620 3:126448282-126448304 CTGTATCTTCACCACATGGCAGG + Intronic
969306269 4:6327836-6327858 CTGGAGCTCCCCCAGCCCGCAGG - Intronic
969720787 4:8892336-8892358 CTGGGTCTCCGCGTCCTCGCTGG + Intergenic
970937959 4:21596908-21596930 CTGGCTCTCCATCTCCTCGGAGG - Intronic
974333190 4:60505966-60505988 CAGGATCTCCACAGCCTCACAGG - Intergenic
974463479 4:62221213-62221235 CTGTTTCTCAACCACCTCGCAGG - Intergenic
980104495 4:128574875-128574897 CTGGCTCCCCACCACCACCCTGG + Intergenic
992067373 5:73120418-73120440 CTGGCTCTCCATTCCCTCGCGGG + Exonic
992329747 5:75703807-75703829 CTGACTCTCCCCCACCTCCCTGG - Intronic
992673332 5:79081263-79081285 CTGGATAGCCACCACCTTCCAGG - Intronic
993944506 5:94101309-94101331 CAGGGTCTCCACAACTTCGCAGG - Intronic
997791624 5:136767323-136767345 CTGTATCTCCAACACCTGCCTGG - Intergenic
998372444 5:141670522-141670544 CTGGACCCTCACCCCCTCGCAGG - Exonic
999309743 5:150544551-150544573 CTGGATCAGCCCCACCTCACAGG + Intronic
1007469848 6:42082412-42082434 CTGCAACTCCTCCACCTCCCGGG + Exonic
1007935775 6:45730500-45730522 CTGTATCTCCACCCCTTCCCTGG - Intergenic
1008290146 6:49705276-49705298 CTGGCTTTCCACCACTTCCCTGG - Intronic
1010369335 6:75089122-75089144 CTGGATCTTCAGGACCTCGGGGG - Exonic
1011225180 6:85097218-85097240 CTGGATTTCCCCCACTTCCCTGG + Intergenic
1018762403 6:166903714-166903736 CTGGAACTCCGCCACATCCCAGG + Intronic
1019769610 7:2875521-2875543 CAGGATCACCTCCACCTCCCAGG + Intergenic
1021989818 7:26130543-26130565 CTGTATCTCCAGCTCCTGGCTGG + Intergenic
1027266016 7:76495673-76495695 CTGCATCTCCAGCACCCCGCTGG - Intronic
1027317390 7:76993790-76993812 CTGCATCTCCAGCACCCCGCTGG - Intergenic
1030972308 7:116075609-116075631 CTGGATTTCCCCCACTTCCCTGG + Intronic
1032072356 7:128816060-128816082 CTGCATCTCCACCTCCCCGAAGG - Intronic
1032753890 7:134869896-134869918 CTGGTTCTCCCCCATCTCCCTGG - Intronic
1034499112 7:151438864-151438886 CTGGAGCTCCATCACCCTGCTGG + Intronic
1034975982 7:155449533-155449555 GTGGGTCTCCACCGCCTCCCGGG - Intergenic
1035908597 8:3540886-3540908 CTGTTTCTCCACAGCCTCGCCGG - Intronic
1036584729 8:10113040-10113062 CTGCAGCTCCATCACCTCACAGG + Intronic
1038375156 8:27032862-27032884 CATGATCTCCTCCACCTCCCAGG + Intergenic
1038658384 8:29474917-29474939 TTGGCTCTCCTCCACCTCCCGGG - Intergenic
1041566831 8:59288046-59288068 CTGTTTGTCCACCACCTCTCTGG + Intergenic
1042127261 8:65550656-65550678 TAGGATTTCCACCTCCTCGCTGG - Intergenic
1045932849 8:107647287-107647309 CTGGATCAGCACCAGCTTGCAGG - Intergenic
1048786106 8:138052152-138052174 CTGGATATCTACCACATCCCAGG - Intergenic
1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG + Intronic
1052297153 9:26909697-26909719 CTGCAACTCCTCCACCTCCCAGG + Intronic
1053600823 9:39607723-39607745 CTTTATCTCCCCCACCTCACAGG - Intergenic
1054252710 9:62734713-62734735 CTTTATCTCCCCCACCTCACAGG + Intergenic
1054566826 9:66769212-66769234 CTTTATCTCCCCCACCTCACAGG + Intergenic
1056666313 9:88583457-88583479 GTGGATTTCCATCACCCCGCTGG + Intronic
1056772856 9:89492300-89492322 CTGGTTATCCCCTACCTCGCTGG + Intronic
1059700465 9:116770935-116770957 ATGGAGCTTCACCACCTCTCTGG + Intronic
1061221370 9:129253967-129253989 CTGGTTATCCACAGCCTCGCGGG + Intergenic
1061836241 9:133331998-133332020 CTGCATCTTCTCCACCACGCCGG + Exonic
1062333939 9:136056705-136056727 ATGGCTCTCCTCCACCTCCCAGG - Intronic
1062374458 9:136255684-136255706 CGGCATCTCCTCCACCTGGCTGG - Intergenic
1186441900 X:9593835-9593857 CTGGATCTCCTCTCCCTCGTCGG + Intronic
1197358906 X:125473272-125473294 CTGTATCTCTAGCACCTAGCAGG + Intergenic
1199953661 X:152725479-152725501 TTGGGTCTCCAGCACATCGCTGG - Intergenic