ID: 1157319985

View in Genome Browser
Species Human (GRCh38)
Location 18:46626775-46626797
Sequence TTGTCTATAAGGATGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157319985_1157319996 26 Left 1157319985 18:46626775-46626797 CCTAGCTTCATCCTTATAGACAA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1157319996 18:46626824-46626846 CTCCTTCATCTATTAGATGGGGG 0: 1
1: 0
2: 2
3: 26
4: 207
1157319985_1157319993 23 Left 1157319985 18:46626775-46626797 CCTAGCTTCATCCTTATAGACAA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1157319993 18:46626821-46626843 AGTCTCCTTCATCTATTAGATGG 0: 1
1: 0
2: 2
3: 14
4: 153
1157319985_1157319994 24 Left 1157319985 18:46626775-46626797 CCTAGCTTCATCCTTATAGACAA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1157319994 18:46626822-46626844 GTCTCCTTCATCTATTAGATGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1157319985_1157319995 25 Left 1157319985 18:46626775-46626797 CCTAGCTTCATCCTTATAGACAA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1157319995 18:46626823-46626845 TCTCCTTCATCTATTAGATGGGG 0: 1
1: 0
2: 4
3: 34
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157319985 Original CRISPR TTGTCTATAAGGATGAAGCT AGG (reversed) Intronic
905281203 1:36850470-36850492 TTGTCGATATGGAGGAAGATGGG - Intronic
906721336 1:48007235-48007257 TTGTTGATAAGAAAGAAGCTGGG + Intergenic
907585731 1:55616092-55616114 TTTTCCATGAGGATGAAACTGGG + Intergenic
909592102 1:77361994-77362016 TTTTTTATAAGGAGGAATCTGGG - Intronic
918297063 1:183166985-183167007 TTGCCTGTAAGGATGGAGCTGGG + Intergenic
920898304 1:210079778-210079800 TTGTCTCTAAGTAATAAGCTGGG - Intronic
1063871167 10:10419446-10419468 TTGACAACAAGGATGAAGCTGGG - Intergenic
1068313181 10:55305865-55305887 ATGTCTACAAGGAGGAAGGTAGG - Intronic
1068662158 10:59633700-59633722 TTGTTTATAAGACTGAAGCTGGG - Intergenic
1071337762 10:84615110-84615132 TTGACTATAAGGTTAAAGTTGGG + Intergenic
1072332366 10:94366151-94366173 ATGGCTATAAGAATGAAGCTTGG - Intergenic
1073844743 10:107542505-107542527 TTGTCAATAAGGGTGAATCCTGG + Intergenic
1074852733 10:117451685-117451707 TGGTCTATAAATATAAAGCTCGG - Intergenic
1078063074 11:8060859-8060881 GTGTCTGTAATGATGATGCTTGG - Intronic
1078952660 11:16152662-16152684 GTGTCTAAAAACATGAAGCTAGG - Intronic
1079037226 11:17030989-17031011 TTTGCTATCAGGATGATGCTGGG + Intergenic
1079070549 11:17341803-17341825 TTTGCTATCAGGATGATGCTGGG + Intronic
1080198340 11:29638060-29638082 TTAACTAAAATGATGAAGCTTGG - Intergenic
1086320267 11:85639059-85639081 TTTTTTAGAATGATGAAGCTAGG - Intergenic
1088006503 11:104947189-104947211 TTGTCTATAATGATACAGATGGG + Exonic
1090475328 11:127015006-127015028 CTGTTAGTAAGGATGAAGCTGGG - Intergenic
1092104953 12:5914720-5914742 CTGCCCACAAGGATGAAGCTTGG + Intronic
1093392217 12:18636699-18636721 TTGGCCATATGGATGAATCTTGG - Intronic
1094106520 12:26817692-26817714 TGGTCTAAAAAGATGAAACTAGG - Intronic
1094106922 12:26822823-26822845 TTTTCCATAAGGTTTAAGCTTGG - Intronic
1095563896 12:43597868-43597890 TTGTCTATAAATATAGAGCTTGG + Intergenic
1095613307 12:44158244-44158266 TTGTCTATAAAAGTAAAGCTTGG + Intronic
1097882749 12:64700860-64700882 TTTTATATAAGGATAAAGGTGGG + Intergenic
1098061452 12:66567624-66567646 ATGTCTATAATGAAGAAGATAGG - Intronic
1101345778 12:103884976-103884998 ATGTGTATAAAGATGATGCTGGG - Intergenic
1104409422 12:128545754-128545776 TTATCTATAAGAATAAATCTTGG - Intronic
1106096839 13:26653796-26653818 TTGTATATAAGTTTGAAACTAGG - Intronic
1106556650 13:30815033-30815055 TTGACTCTATAGATGAAGCTGGG + Intergenic
1108921229 13:55676803-55676825 TTTTCTATATGGATGAACTTTGG - Intergenic
1109215875 13:59589276-59589298 TTCCTGATAAGGATGAAGCTGGG + Intergenic
1111834506 13:93371211-93371233 TTTTCATTGAGGATGAAGCTTGG + Intronic
1114196200 14:20478551-20478573 TAGTCTTGAAGGATGAAGCAGGG + Intergenic
1114990629 14:28283598-28283620 TTGAATATATGGATAAAGCTGGG - Intergenic
1118811313 14:69276377-69276399 TTTTTTATAAGAAAGAAGCTTGG + Intronic
1120076909 14:80169298-80169320 TAGTCCATAATGATGAAGCTTGG + Intergenic
1123185741 14:106515338-106515360 TTGTCTTTGAGGAAGAAGATTGG - Intergenic
1124707869 15:31980229-31980251 GTGTCTATATGGGTGAAGTTAGG + Intergenic
1127502888 15:59571074-59571096 TTGTGTTTAAGAATGAAGATGGG - Intergenic
1130861553 15:87895345-87895367 TTGGTTCTGAGGATGAAGCTCGG + Intronic
1131660785 15:94513111-94513133 TTGTCTATTAAAATTAAGCTAGG - Intergenic
1135759360 16:25124601-25124623 TGGCCTATAAGGATCAAGCCTGG - Intronic
1136285087 16:29236124-29236146 TTTTCTATGGGGAGGAAGCTGGG + Intergenic
1142090153 16:88205748-88205770 TTTTCTATGGGGAGGAAGCTGGG + Intergenic
1145285367 17:21501966-21501988 TTGTGTAGCAGGAAGAAGCTTGG - Intergenic
1150304187 17:64070444-64070466 TTTTATATCTGGATGAAGCTGGG + Intronic
1153023452 18:653140-653162 TTGTTTAAATGGATGATGCTGGG - Intronic
1154013222 18:10593248-10593270 TTATAAATAAGTATGAAGCTTGG - Intergenic
1154152387 18:11916511-11916533 TTATAAATAAGTATGAAGCTTGG - Intergenic
1157066216 18:44353875-44353897 TTTTGTATGAGGATGATGCTGGG + Intergenic
1157152019 18:45227790-45227812 ATGCCTGTAAAGATGAAGCTTGG - Intronic
1157319985 18:46626775-46626797 TTGTCTATAAGGATGAAGCTAGG - Intronic
1159367415 18:67486431-67486453 TTGTCCATATAGATAAAGCTTGG - Intergenic
1162327954 19:10009761-10009783 TTGCCCATGAGGATGAAGGTGGG - Intronic
1162909517 19:13841752-13841774 TGGTCTATGAGGGTGAGGCTGGG - Intergenic
1166182225 19:41117004-41117026 TTGTGGATAGGGATGAAGGTGGG - Intronic
929546937 2:42861931-42861953 TTAAATATAAGGATGAGGCTAGG - Intergenic
932467725 2:71934290-71934312 TTCTTTGTAAGGATGAATCTTGG + Intergenic
933049256 2:77581902-77581924 TTGTCTATAAAAATGTAGATTGG - Intronic
938309781 2:130281697-130281719 TTGTTTGTAGGGATGAAGCAGGG - Intergenic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
943234032 2:185294584-185294606 TTTGGTATCAGGATGAAGCTGGG - Intergenic
943324771 2:186485164-186485186 TTATCTATAAAGATGATTCTTGG + Intergenic
944136575 2:196406171-196406193 ATGTCAAGAAGGAAGAAGCTGGG - Intronic
944689480 2:202146823-202146845 TAGCCTATAAGGAAGAAGTTGGG - Intronic
947106127 2:226669652-226669674 TTGGCTATCAGGCTGAAGTTCGG + Intergenic
1171289514 20:23973873-23973895 TTGGCTATAAGAATGAAGAATGG + Intergenic
1173529129 20:43755117-43755139 TTGACTCTAAGGATGTAGCAGGG - Intergenic
1177287455 21:19071006-19071028 TTGTCCCCAAGGATGAAGGTGGG + Intergenic
1177438324 21:21084804-21084826 TTGTTTATATGGATGAATATAGG + Intronic
1180301479 22:11039911-11039933 TTTTCTTTAAGGGTGAAGGTTGG - Intergenic
1180897488 22:19347606-19347628 TTATCCATGAGGAAGAAGCTAGG + Intronic
950281586 3:11712297-11712319 TTTTCTTTAAGGAGGAAACTAGG - Intronic
951516406 3:23564780-23564802 TTGTCTTTAATGATGTATCTTGG + Intronic
951739340 3:25903342-25903364 TGGGCTAACAGGATGAAGCTCGG - Intergenic
959088672 3:101878640-101878662 TTGTCTATCAGTATGAAACCAGG - Intergenic
961577462 3:127849468-127849490 TTTCCTCTAAGGATGTAGCTGGG + Intergenic
963562368 3:146882007-146882029 TTGACTATGGGGATGAAGCTAGG - Intergenic
967714377 3:192745446-192745468 TTGTCTATACAGTTGAACCTTGG + Intronic
967911869 3:194549216-194549238 CTGTCTATTAGGCTGTAGCTTGG + Intergenic
969293960 4:6258267-6258289 TTGACTATAACGATTAAGATTGG - Intergenic
974665982 4:64962230-64962252 TTCTCTATAATCAAGAAGCTGGG - Intergenic
976325913 4:83771494-83771516 TTGTGTTTTGGGATGAAGCTAGG + Intergenic
977296400 4:95214309-95214331 CTGTTTATAAAAATGAAGCTAGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
980391094 4:132147687-132147709 TTGTGTTTAAGGAACAAGCTAGG + Intergenic
980557244 4:134425058-134425080 TTATATATAAGGATCAAGCAGGG - Intergenic
984269573 4:177534937-177534959 CTGTTTATAAAGATGCAGCTAGG - Intergenic
985851908 5:2394710-2394732 TTGTATCTAAAGACGAAGCTGGG + Intergenic
986441146 5:7782935-7782957 TTCTCTCTGAGAATGAAGCTGGG - Intronic
988700801 5:33672734-33672756 TTCTCCACAAGGATGAAGGTGGG - Intronic
989054126 5:37350254-37350276 TTTTCTTTAAGGCTGAAGCAGGG - Exonic
992405131 5:76449683-76449705 GTGTCTACAATTATGAAGCTAGG - Intronic
992601905 5:78409760-78409782 TAGTAGATAAGGATGAAGGTAGG - Intronic
992930936 5:81644393-81644415 TGGTCTCTTAGGAAGAAGCTCGG + Intronic
994207389 5:97050640-97050662 CTGTATTTAAGGAGGAAGCTGGG + Intergenic
995034644 5:107519439-107519461 TTTTCCAAAAGGATTAAGCTAGG - Intronic
998215128 5:140232271-140232293 TTGTATATAAACCTGAAGCTTGG + Intronic
998438208 5:142132218-142132240 TTGACTACAAGGATGAGTCTGGG + Exonic
998557202 5:143137080-143137102 TTATGTATCAGGATGAAGCCAGG - Intronic
998914352 5:146997772-146997794 TTGTCTATAGAGATGTTGCTAGG - Intronic
1001658949 5:173375982-173376004 TTGTCTAAAGGTATGCAGCTAGG - Intergenic
1001907352 5:175484248-175484270 TTGTCTGGAAGGTTGAAACTGGG - Intronic
1003700108 6:8454668-8454690 GTATATATAAGGATGAATCTTGG + Intergenic
1003757312 6:9136308-9136330 TTCTCTATAAGGCTGAACCTTGG - Intergenic
1003854226 6:10255916-10255938 TGGTGTATAAGGAAGGAGCTTGG + Intergenic
1004457143 6:15801647-15801669 TTGCCTTTCAGGATGAAGGTGGG + Intergenic
1005427652 6:25720010-25720032 TTCTCTATAAGCATAAAGGTTGG + Intergenic
1015100550 6:129474005-129474027 TAGTCTATAAGGATGGTACTTGG + Intronic
1015255579 6:131176041-131176063 TTGTCTATAACAATGAATATAGG + Intronic
1015426923 6:133081759-133081781 TTGTTTATATGAATGAAGATAGG - Intergenic
1016606732 6:145937457-145937479 TTGTCTATAAGAAGTAATCTAGG - Intronic
1020466568 7:8486304-8486326 TGTTCTTTAAGGATAAAGCTAGG + Intronic
1021537042 7:21717019-21717041 TTCTCACTAAGGATGAAGCATGG - Intronic
1023160125 7:37288820-37288842 TTGTTTATAAACATGAACCTAGG + Intronic
1029093903 7:98069983-98070005 TTGTCTATAAGTCTCATGCTTGG - Intergenic
1029596736 7:101541850-101541872 CTGTCTATAAGGCTGAATCCAGG + Intronic
1029636425 7:101787528-101787550 TTGTCTATGAGGATAAAAGTAGG - Intergenic
1032844677 7:135742309-135742331 TTGTCCATAATGATGAAGGCTGG + Intronic
1034239441 7:149598513-149598535 TGGCCTATAAGGTTGAAGCAAGG - Intergenic
1042668685 8:71235458-71235480 TTGTCAAGAAGGGAGAAGCTGGG - Intronic
1042941301 8:74111504-74111526 TTTTCTGTAAGGATGTAGCAGGG - Intergenic
1043558387 8:81461110-81461132 CTGTCTATAAATTTGAAGCTGGG + Intronic
1045448193 8:102289219-102289241 TTGTCTTTAAGGATTAAGGGTGG - Intronic
1047064374 8:121263859-121263881 ATTTCCATCAGGATGAAGCTAGG + Intergenic
1047127325 8:121976693-121976715 TGGTTTCTAAGGATGAGGCTTGG - Intergenic
1047909955 8:129517245-129517267 CTGTCTATCAGGATCAAGGTTGG - Intergenic
1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG + Intergenic
1061118501 9:128629148-128629170 GTGTCTATCAGTATGAAGTTGGG + Intronic
1186150871 X:6673208-6673230 TTATCTATAAGGATAGAACTTGG - Intergenic
1187879759 X:23835882-23835904 TTTTCTACAAGGATTGAGCTGGG - Intronic
1191735339 X:64382998-64383020 CTGTATTTAAGGGTGAAGCTTGG - Intronic
1191916217 X:66204160-66204182 TTGTCTATAAGGACACAGCATGG + Intronic
1194905345 X:99569018-99569040 TTTGATATAAGAATGAAGCTGGG + Intergenic
1197135483 X:123055002-123055024 TTGTCTATGAGGATGGATGTTGG + Intergenic
1199406914 X:147472876-147472898 TTGTATATAGAGATGAACCTAGG - Intergenic