ID: 1157320610

View in Genome Browser
Species Human (GRCh38)
Location 18:46631191-46631213
Sequence TGAAGCTCAGGTTGCTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157320610_1157320615 6 Left 1157320610 18:46631191-46631213 CCCTCAGAGCAACCTGAGCTTCA No data
Right 1157320615 18:46631220-46631242 AAACTGGAGAGATACACATTAGG No data
1157320610_1157320614 -10 Left 1157320610 18:46631191-46631213 CCCTCAGAGCAACCTGAGCTTCA No data
Right 1157320614 18:46631204-46631226 CTGAGCTTCACTGGAGAAACTGG No data
1157320610_1157320616 28 Left 1157320610 18:46631191-46631213 CCCTCAGAGCAACCTGAGCTTCA No data
Right 1157320616 18:46631242-46631264 GAAGTTAGAGCCCTGAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157320610 Original CRISPR TGAAGCTCAGGTTGCTCTGA GGG (reversed) Intronic