ID: 1157320613 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:46631203-46631225 |
| Sequence | CAGTTTCTCCAGTGAAGCTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1157320613_1157320615 | -6 | Left | 1157320613 | 18:46631203-46631225 | CCTGAGCTTCACTGGAGAAACTG | No data | ||
| Right | 1157320615 | 18:46631220-46631242 | AAACTGGAGAGATACACATTAGG | 0: 1 1: 0 2: 0 3: 18 4: 259 |
||||
| 1157320613_1157320618 | 26 | Left | 1157320613 | 18:46631203-46631225 | CCTGAGCTTCACTGGAGAAACTG | No data | ||
| Right | 1157320618 | 18:46631252-46631274 | CCCTGAAATATGGTATTTCTTGG | No data | ||||
| 1157320613_1157320616 | 16 | Left | 1157320613 | 18:46631203-46631225 | CCTGAGCTTCACTGGAGAAACTG | No data | ||
| Right | 1157320616 | 18:46631242-46631264 | GAAGTTAGAGCCCTGAAATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1157320613 | Original CRISPR | CAGTTTCTCCAGTGAAGCTC AGG (reversed) | Intronic | ||