ID: 1157320614

View in Genome Browser
Species Human (GRCh38)
Location 18:46631204-46631226
Sequence CTGAGCTTCACTGGAGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157320609_1157320614 1 Left 1157320609 18:46631180-46631202 CCGCAGTGTTACCCTCAGAGCAA No data
Right 1157320614 18:46631204-46631226 CTGAGCTTCACTGGAGAAACTGG No data
1157320608_1157320614 20 Left 1157320608 18:46631161-46631183 CCAGGTAGATAGGAGGAGACCGC No data
Right 1157320614 18:46631204-46631226 CTGAGCTTCACTGGAGAAACTGG No data
1157320607_1157320614 26 Left 1157320607 18:46631155-46631177 CCATCACCAGGTAGATAGGAGGA No data
Right 1157320614 18:46631204-46631226 CTGAGCTTCACTGGAGAAACTGG No data
1157320610_1157320614 -10 Left 1157320610 18:46631191-46631213 CCCTCAGAGCAACCTGAGCTTCA No data
Right 1157320614 18:46631204-46631226 CTGAGCTTCACTGGAGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157320614 Original CRISPR CTGAGCTTCACTGGAGAAAC TGG Intronic