ID: 1157320615

View in Genome Browser
Species Human (GRCh38)
Location 18:46631220-46631242
Sequence AAACTGGAGAGATACACATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157320609_1157320615 17 Left 1157320609 18:46631180-46631202 CCGCAGTGTTACCCTCAGAGCAA No data
Right 1157320615 18:46631220-46631242 AAACTGGAGAGATACACATTAGG No data
1157320611_1157320615 5 Left 1157320611 18:46631192-46631214 CCTCAGAGCAACCTGAGCTTCAC No data
Right 1157320615 18:46631220-46631242 AAACTGGAGAGATACACATTAGG No data
1157320613_1157320615 -6 Left 1157320613 18:46631203-46631225 CCTGAGCTTCACTGGAGAAACTG No data
Right 1157320615 18:46631220-46631242 AAACTGGAGAGATACACATTAGG No data
1157320610_1157320615 6 Left 1157320610 18:46631191-46631213 CCCTCAGAGCAACCTGAGCTTCA No data
Right 1157320615 18:46631220-46631242 AAACTGGAGAGATACACATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157320615 Original CRISPR AAACTGGAGAGATACACATT AGG Intronic