ID: 1157320616

View in Genome Browser
Species Human (GRCh38)
Location 18:46631242-46631264
Sequence GAAGTTAGAGCCCTGAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157320610_1157320616 28 Left 1157320610 18:46631191-46631213 CCCTCAGAGCAACCTGAGCTTCA No data
Right 1157320616 18:46631242-46631264 GAAGTTAGAGCCCTGAAATATGG No data
1157320613_1157320616 16 Left 1157320613 18:46631203-46631225 CCTGAGCTTCACTGGAGAAACTG No data
Right 1157320616 18:46631242-46631264 GAAGTTAGAGCCCTGAAATATGG No data
1157320611_1157320616 27 Left 1157320611 18:46631192-46631214 CCTCAGAGCAACCTGAGCTTCAC No data
Right 1157320616 18:46631242-46631264 GAAGTTAGAGCCCTGAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157320616 Original CRISPR GAAGTTAGAGCCCTGAAATA TGG Intronic