ID: 1157321249

View in Genome Browser
Species Human (GRCh38)
Location 18:46636337-46636359
Sequence GTAGGCACAGAAGGTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157321249 Original CRISPR GTAGGCACAGAAGGTGAGCT GGG (reversed) Intronic
901218259 1:7566869-7566891 GTGGGCACAGAGGGGGTGCTCGG - Intronic
901298967 1:8184548-8184570 GTCAGCACGGAAGGTGAGATGGG + Intergenic
902342636 1:15794090-15794112 GTAAGCACAGAATCAGAGCTGGG + Intergenic
903593075 1:24471899-24471921 GGAGAAACAGAAGGTGAGCAGGG + Intronic
904701920 1:32362834-32362856 GGAGGGCCAGAAGGTGAGCCGGG + Exonic
905263312 1:36734198-36734220 GCAGGGACAGGAGGTTAGCTCGG - Intergenic
905410591 1:37765432-37765454 GTAGGCAGGCAAGGTGGGCTTGG + Intergenic
906510454 1:46407693-46407715 GTGGGCACAGAGGATGACCTAGG - Intronic
906563586 1:46779014-46779036 GGAGGCACAGAGAGTGAGCAAGG + Intronic
907178647 1:52550611-52550633 GTAGTCCCAGAAGCTGAGGTAGG - Intronic
907954556 1:59215728-59215750 GTGGGCAGAGATGCTGAGCTGGG - Intergenic
909718627 1:78740062-78740084 CTAGGCACACAATGTAAGCTGGG - Intergenic
910327117 1:86022563-86022585 CAAGGCACAGCAGGAGAGCTAGG - Exonic
911393670 1:97278031-97278053 TTAGTCACATAAGGTGAACTAGG - Intronic
913074132 1:115326820-115326842 GTAGACACAGAAGGTAAGATGGG - Intronic
913178721 1:116298496-116298518 GGAGGCACAGAGAGTGAGCGAGG + Intergenic
915209199 1:154294346-154294368 GTAGGCCCAGAAGTTGAATTTGG + Intergenic
915799697 1:158777123-158777145 GTAAGCACAAAATGGGAGCTGGG + Exonic
917525953 1:175788712-175788734 GTAGGTCCAAAATGTGAGCTGGG - Intergenic
919465711 1:197920117-197920139 CTTGGCAAAGCAGGTGAGCTCGG - Exonic
919506135 1:198399606-198399628 GTGGCCACAGAAGCTGAGATTGG + Intergenic
921052145 1:211518299-211518321 GTATGCCCAGAGGCTGAGCTTGG - Intergenic
921818133 1:219587006-219587028 GCAGGAAAAGAAGGTGGGCTGGG - Intergenic
923030636 1:230246700-230246722 GTAGGCACAGGTGTTGGGCTGGG - Intronic
1064513801 10:16124383-16124405 GGAGGAACACAAGTTGAGCTTGG - Intergenic
1064573716 10:16723113-16723135 GTTGGCACATAATTTGAGCTGGG + Intronic
1065686686 10:28292392-28292414 GTAGAAACAGAAGCTGAACTAGG + Intronic
1069537642 10:69266736-69266758 GCAGGCACAGAAGGAGAACTAGG + Exonic
1070266666 10:74909572-74909594 TGAGGCAGAGAAGGTGAGCCTGG - Intronic
1071347238 10:84704356-84704378 GTGGTCACAGAAAGTCAGCTGGG - Intergenic
1072709966 10:97709816-97709838 GTAGGCTCAGATGGGCAGCTGGG - Intergenic
1073001809 10:100291291-100291313 GGAGGAAGAGAGGGTGAGCTGGG - Exonic
1073355063 10:102847461-102847483 GTAGGCCTTGAAGGAGAGCTAGG + Intergenic
1073441660 10:103555959-103555981 GTAGGCACTGAAGGTGCCCGTGG + Intronic
1073452576 10:103618482-103618504 GTTGCCCCAGAAGGTGAGGTGGG - Intronic
1073547728 10:104365996-104366018 GAAGGAGCAGAAGGTGAGTTGGG + Exonic
1074450272 10:113553748-113553770 TGAGGCAGAGAAGGTGAGCAGGG + Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1079111104 11:17605690-17605712 GCAGGCAGAGTAGGTGGGCTGGG + Intronic
1079114389 11:17631891-17631913 GCAGGCACTGAAGGTGCGGTTGG - Exonic
1084583206 11:70037416-70037438 GTGTCCTCAGAAGGTGAGCTTGG - Intergenic
1084856893 11:71995204-71995226 ATAGGCAGAGAATGGGAGCTGGG - Intronic
1084940815 11:72612022-72612044 GGAGGCACAGATGGGGAGCAAGG + Intronic
1085478285 11:76801548-76801570 GTAAGCACATAAAGTGAGCAAGG - Intergenic
1085819446 11:79776610-79776632 GAAGAGACAGAAGGTGGGCTGGG + Intergenic
1086060749 11:82697222-82697244 TTTGGCACAGAAAGTGAGGTAGG - Intergenic
1088469176 11:110175945-110175967 GTAGGCAATGAAGTTGAGCTTGG - Intronic
1089788045 11:120922081-120922103 GCAGGCACAGAAGGTGACATAGG - Intronic
1090025927 11:123167777-123167799 GAAGTCACAGCAGGTGAGATTGG - Intronic
1090642214 11:128739512-128739534 GGAGGTAGGGAAGGTGAGCTGGG - Intronic
1091882409 12:3990517-3990539 GTGGGCCCAGAAGGGGAGGTGGG + Intergenic
1094133778 12:27102506-27102528 AGAGGCACAGAAGGTGTGGTGGG - Intergenic
1095875464 12:47075926-47075948 GCAGGGAAAGAAGGAGAGCTGGG - Exonic
1096043760 12:48543860-48543882 GGAGGCCCAGAAGGTTAGCAGGG + Intergenic
1096255507 12:50059631-50059653 GTAGGCAAGGAAGGAGAGCTGGG - Intronic
1096442852 12:51660411-51660433 GTAGGAACAGAGAGTGACCTAGG + Intronic
1102344660 12:112151953-112151975 TTCGGCACACAAGGAGAGCTGGG - Exonic
1102660857 12:114526967-114526989 GTAGGCAGAGAAGATGACCGAGG - Intergenic
1103005545 12:117417495-117417517 TCTGGCACAGAAGGTGAGCTGGG - Intronic
1103859609 12:124001806-124001828 GAAGGCACAGAAGCTGACATAGG + Intronic
1103935871 12:124476206-124476228 GTTGGCACAGAAGGGGTGTTGGG - Intronic
1105607446 13:21938085-21938107 GGAGCCACAGAAGGTGAGCGTGG + Intergenic
1107404325 13:40098552-40098574 GCAGGCGCAGCAGGTGAGGTGGG - Intergenic
1108090563 13:46845273-46845295 AAAGGCACAGGAGCTGAGCTGGG + Intronic
1110646224 13:77888032-77888054 GTAGTCATAGAAGGAGAGATTGG - Intergenic
1111643222 13:90996952-90996974 GTAAACACAGAAGGAGAGGTTGG + Intergenic
1112691255 13:101897177-101897199 CTAGGCACATATGGTGAGCGGGG - Intronic
1114427256 14:22634302-22634324 GGAGCCACAGAAGGGCAGCTGGG + Exonic
1120867546 14:89308851-89308873 GTAAGCACAGCAGGGGAGCCTGG + Intronic
1121078381 14:91088085-91088107 CCAGGCAGAGAAGGTGAGCTGGG + Intronic
1122792655 14:104190860-104190882 GCAGGCACAGAGGCTGAGGTGGG + Intergenic
1122943949 14:104996541-104996563 GGAGGCCCAGCAGGGGAGCTGGG + Intronic
1123207739 14:106729476-106729498 GTAAGCACTGAAGCTGAGCATGG + Intergenic
1123403430 15:20006718-20006740 GCAGGCACAGAGCGTGGGCTGGG - Intergenic
1123512768 15:21013372-21013394 GCAGGCACAGAGCGTGGGCTGGG - Intergenic
1128111919 15:65081879-65081901 TTAGACAGAGAAGGTGGGCTGGG - Intergenic
1128213489 15:65918039-65918061 GTTGGCACAGGAGCAGAGCTGGG + Exonic
1128736888 15:70058526-70058548 GCAGGCACAGAAGGTAAACCGGG + Intronic
1130862151 15:87900734-87900756 GTAGGCAGTGAAGGAGAGCATGG + Intronic
1131449969 15:92531223-92531245 GTGGGCACAGCAGGTAAACTGGG - Intergenic
1133411602 16:5573487-5573509 GTATGCACAGCAGGTGACTTGGG + Intergenic
1134133684 16:11666465-11666487 CCAGGCACAGGAGGTGAGCTGGG - Intergenic
1134438375 16:14282327-14282349 CCAGGCACACAAGGTGAGCCAGG + Intergenic
1138156885 16:54714053-54714075 GCAGACACAGAAGCTGAGTTAGG + Intergenic
1138515131 16:57531736-57531758 AGGAGCACAGAAGGTGAGCTGGG - Intronic
1140209804 16:72961045-72961067 GTAGGTGCAAAACGTGAGCTTGG + Intronic
1140918193 16:79512540-79512562 GTCAGCTCAGATGGTGAGCTGGG - Intergenic
1141211783 16:81987815-81987837 GGAGGCTCAGTATGTGAGCTGGG - Intergenic
1142164811 16:88580611-88580633 GCAGGCACAGGAGGTGGGCTTGG - Intronic
1144757360 17:17687731-17687753 GTAAGCATTAAAGGTGAGCTGGG + Intronic
1144859052 17:18288608-18288630 GTGGCCATAGAAGGTGAGCCTGG - Intronic
1145760418 17:27422364-27422386 CTAAGCACAGAAGGTGACATAGG + Intergenic
1146590141 17:34121721-34121743 GTAGGGGCAGGAGGTGATCTAGG - Intronic
1146755334 17:35426897-35426919 TAAGGCTCAGAAGATGAGCTGGG - Intronic
1147156329 17:38546204-38546226 GTAGGCACTGAAGGTGAGGAAGG - Intronic
1147529584 17:41263083-41263105 GGAGGAACAGAAGGTGAGAGAGG + Intergenic
1147664599 17:42138542-42138564 AGGGGCACTGAAGGTGAGCTGGG + Intronic
1150138934 17:62712488-62712510 AAAGGCACAGAAGTTGAGCAAGG + Intronic
1151746486 17:76014416-76014438 GCAGGCGCAGAAGGTGAGGCTGG - Exonic
1152218459 17:79048039-79048061 GTAGCCACTGAAGGTGATGTAGG - Exonic
1152584382 17:81182443-81182465 GAGGGCACACAAGGTGGGCTGGG + Intergenic
1156484364 18:37455612-37455634 GTGGACACAGAATGTGAGCATGG + Intronic
1156925993 18:42580022-42580044 CTAGTCACAGAAGGAGAGGTAGG - Intergenic
1156971227 18:43159224-43159246 CTAGGCACAGAGGCTGATCTTGG + Intergenic
1157321249 18:46636337-46636359 GTAGGCACAGAAGGTGAGCTGGG - Intronic
1157408624 18:47445150-47445172 CTTGGCAGAGAAGGTGAGCTGGG - Intergenic
1159176450 18:64841543-64841565 GCAGGCAGAAAAGTTGAGCTAGG - Intergenic
1159953279 18:74501226-74501248 GCAGCCACAGAGGGTGAGCCTGG + Intronic
1160097865 18:75891619-75891641 CTAGGCACAGAAGATGAGCTAGG + Intergenic
1160416428 18:78714797-78714819 CTAGGAACAGAAAGTGAGCACGG + Intergenic
1160914425 19:1490007-1490029 GGAGTCCCAGAAGCTGAGCTTGG + Intronic
1160973389 19:1780289-1780311 GTAGGCTCCGAAAGTGGGCTGGG - Exonic
1162550762 19:11357121-11357143 GTTGGCAGAGAAGGAGGGCTTGG + Intronic
1163144214 19:15369810-15369832 GAGGGCACAGAAGATGGGCTGGG + Intronic
1164089821 19:21939668-21939690 ATAGGCACAGAATAAGAGCTTGG + Intronic
1164866126 19:31605854-31605876 GTGGGCACAGAAGCTGAGAGGGG + Intergenic
1165309433 19:35021606-35021628 GTAGGGACAGAAGGCCGGCTGGG + Intronic
1165720243 19:38073851-38073873 GTGGGCACAGGACGTGGGCTTGG - Intronic
1165827015 19:38711349-38711371 GGGGGCTCAGAAGGTGAGCTGGG + Intronic
1166645026 19:44525186-44525208 GTTGGCATTGAGGGTGAGCTGGG + Exonic
1167086308 19:47312019-47312041 GTAGAGACAGAAGCTGAGCTCGG - Intronic
1167613262 19:50517458-50517480 GTGGTCCCAGAAGGTGGGCTGGG + Exonic
925085033 2:1101157-1101179 GGAGGCACAGAATGCGAGCCTGG - Intronic
925171535 2:1752988-1753010 GTTGTCACTGAAGGTGAGCTAGG + Intergenic
927347440 2:22062147-22062169 AAAGGCAGAGAAGGTGAACTAGG - Intergenic
929819636 2:45262805-45262827 GGAGGAGGAGAAGGTGAGCTGGG - Intergenic
929904230 2:46032257-46032279 ATAGGCACAAACGATGAGCTGGG + Intronic
932001833 2:67892480-67892502 GCAGGCACATAAAGAGAGCTTGG + Intergenic
934134118 2:88978954-88978976 GGAGGAAGAGAAGCTGAGCTGGG + Intergenic
934139055 2:89027654-89027676 GGAGGAAGAGAAGCTGAGCTGGG + Intergenic
936547996 2:113409351-113409373 GGAGACAGAGAAGCTGAGCTGGG - Intergenic
937378326 2:121353241-121353263 GAAGGCACAGCAGCTGAGCCGGG + Intronic
938063491 2:128269260-128269282 GCAGGAACAGAAGGTGGGCAGGG + Intronic
938329666 2:130440907-130440929 GTAGACACCGCAGGTAAGCTGGG - Intergenic
939239580 2:139540133-139540155 GTAGGCGCAAAAGCTGAACTGGG - Intergenic
941807000 2:169719467-169719489 GTAGGCACAGGAGCTGGGGTAGG - Intronic
941843238 2:170109746-170109768 TGTGGCACAGAAGGTGGGCTGGG + Intergenic
943305861 2:186261894-186261916 GTTGGCACAGAAGGTGAAGAAGG - Intergenic
946077015 2:217082701-217082723 GTAGGCTTTCAAGGTGAGCTGGG + Intergenic
946330085 2:219004073-219004095 GAAGGAAGAGAAAGTGAGCTGGG - Exonic
947074643 2:226329308-226329330 GCAGGCACAGGAGGGGAGGTTGG - Intergenic
947277919 2:228415712-228415734 GTAGGGACAGTAAGTGGGCTTGG + Intergenic
947445404 2:230159002-230159024 GTGGACACAAAAGGTGAGATTGG - Intergenic
947539355 2:230964449-230964471 GTAGCCACAGAGAGTGCGCTGGG - Intergenic
948397975 2:237661527-237661549 GCAGGAACAGAAGGTGAACCAGG - Intronic
948948875 2:241236236-241236258 GACTGCACACAAGGTGAGCTAGG + Intronic
1169035801 20:2451041-2451063 GAAGGGACAGAAAGTGAGGTAGG - Intergenic
1169065344 20:2692031-2692053 GGAGAAACAGGAGGTGAGCTGGG + Intergenic
1169377852 20:5081403-5081425 ATGGGCACAGCAGGGGAGCTGGG + Intronic
1170355873 20:15490870-15490892 GTTGGGACAGAAGTTGAGGTAGG - Intronic
1171880553 20:30615141-30615163 GTAGGCACCACAGGTAAGCTGGG - Intergenic
1175839949 20:62020315-62020337 GTAGCCTCAGGAGGAGAGCTGGG - Intronic
1180589673 22:16926414-16926436 GGAGGCAGAGAAGCTGAGATGGG + Intergenic
1182198339 22:28542346-28542368 GGAGCCACAGAAGGTGAGGAAGG + Intronic
1182463065 22:30495757-30495779 GTGGGGACAGGAGGTGGGCTGGG + Intronic
1184898124 22:47424202-47424224 GGAGGGACAGAGGGGGAGCTGGG + Intergenic
950370179 3:12522822-12522844 GTAGGCAAATAAGGTCAACTAGG - Intronic
952921521 3:38288059-38288081 GTAGGTACAGAATTTCAGCTTGG - Intronic
953638049 3:44679299-44679321 GTAGGCAAAAAAGGGGTGCTAGG - Intergenic
954720831 3:52561457-52561479 GTAAGCACACATGTTGAGCTAGG - Intronic
956890822 3:73612587-73612609 GGAAGCAGAGAAGGTGAACTTGG + Intronic
957486748 3:80871409-80871431 CTAGGCACAGAACGAGAACTTGG + Intergenic
960142417 3:114163854-114163876 ATAGGCACCAAAGGTGAGATAGG + Intronic
963783452 3:149509848-149509870 GCAGGGAGAGAAGGAGAGCTGGG + Intergenic
965432983 3:168612338-168612360 ATAGGCACAGGAGGGGGGCTTGG - Intergenic
969439321 4:7208078-7208100 GAAGGCAAAGAAGATCAGCTGGG + Intronic
969583500 4:8079007-8079029 GGAGGAAAAGAACGTGAGCTGGG - Intronic
969857327 4:10010776-10010798 GGGGGAACAGAAGGTGAGGTGGG - Intronic
971040958 4:22751526-22751548 GTAGGCACAGGACGTGAGCTGGG + Intergenic
971670775 4:29553997-29554019 GTAGGCAAAGAAGGTGAGTCTGG - Intergenic
972172600 4:36364983-36365005 GGTGGCACATAAGGTGAGATGGG - Intergenic
975601858 4:76108959-76108981 GTAGGCCCAGAAGTTGCTCTGGG + Intronic
977880198 4:102195976-102195998 GAAGGCACAGTATGTGAGATAGG + Intergenic
981833872 4:149031916-149031938 AAAGGCACAGATGGTGAGATGGG - Intergenic
986488173 5:8261664-8261686 GTAGGAACAGCAGGTGAGTGGGG + Intergenic
988829802 5:34976497-34976519 GTACTCACAGAAGGTGGGCCTGG + Intergenic
989168637 5:38454063-38454085 GCAGGCACAGAAGTCGACCTCGG - Intronic
990522821 5:56595933-56595955 GGAGGCAAAGGAGGAGAGCTTGG + Intronic
991011246 5:61885047-61885069 GGAGGCACAGCAGGTGACATAGG + Intergenic
991462692 5:66876315-66876337 GTGGGCCTAGAAGGTGAGGTGGG + Intronic
991500159 5:67268802-67268824 GAAGGCAGAGAGGGAGAGCTGGG - Intergenic
992448066 5:76851378-76851400 GTAGGTGCAGGAGGTGAGTTGGG + Intronic
992560876 5:77951605-77951627 GGAGGCAAAGAAGGAGAGATAGG + Intergenic
992743117 5:79793705-79793727 GTTGGCTCAGAAGTTGAGCATGG - Intronic
994968750 5:106708467-106708489 GTAGTCACAGAATGAGAACTTGG + Intergenic
996916564 5:128719569-128719591 GTAGCTACAGAAGGTGAAATAGG + Intronic
997619273 5:135274281-135274303 GTAGGGACTGAAGGTCAGGTTGG - Intronic
1001650004 5:173309566-173309588 GAGGGGACAGAAGGAGAGCTGGG - Intergenic
1002085433 5:176772129-176772151 GTGGCCACAGAAGCAGAGCTTGG + Intergenic
1003488165 6:6597361-6597383 GAAGGCACAGAACGGGAGCAGGG + Intronic
1006044017 6:31278743-31278765 GTAGGCACATAAGGAGACATAGG + Intronic
1006331979 6:33398154-33398176 GGAGCCTGAGAAGGTGAGCTGGG + Exonic
1007470682 6:42088383-42088405 GGAGGGAGAGAAGGTGACCTAGG + Intergenic
1013179708 6:107707802-107707824 GCAGGCACAGAAGGAGAGTGAGG - Intronic
1014845288 6:126268367-126268389 GGAGGCACTGGAGTTGAGCTGGG + Intergenic
1017005452 6:150025432-150025454 GGAGGCACAGAAGCAAAGCTGGG + Exonic
1017333697 6:153229547-153229569 GTAGGGAAAGAAGATGAGTTTGG + Intergenic
1018378318 6:163234105-163234127 GCAGGGACAGAAGATGATCTAGG + Intronic
1018424281 6:163666489-163666511 CTTGGCAGAGAACGTGAGCTCGG - Intergenic
1018977248 6:168574836-168574858 TTAGGCACAGAGGGTGACATGGG + Intronic
1019062056 6:169263622-169263644 TGAGGCACAGAAGGGCAGCTGGG - Intergenic
1019624105 7:2007078-2007100 GGAGGCACAGATGGGCAGCTGGG + Intronic
1020405112 7:7824240-7824262 GTAGTTACTGAAGGTGAGCCGGG - Intronic
1022459564 7:30592731-30592753 GTTGGGCCAGAATGTGAGCTGGG - Intergenic
1024208843 7:47186600-47186622 GTAGACACAGACAGAGAGCTAGG - Intergenic
1024466765 7:49719591-49719613 GAGGGCACAGAAGGTGAGGCTGG + Intergenic
1032856746 7:135841159-135841181 ATATGCACAGAAGGTTATCTAGG + Intergenic
1032903211 7:136334802-136334824 CTAGGCACAGAAGGAGACATGGG - Intergenic
1033636847 7:143219563-143219585 GTGGGAACAGAAGGAGATCTTGG - Intergenic
1033768257 7:144519124-144519146 GCAGACACAGAAGGTGAATTTGG + Intronic
1034376939 7:150653794-150653816 CTTTGCTCAGAAGGTGAGCTGGG - Intergenic
1034398918 7:150848477-150848499 GCAGGTAAAGAAGGTGTGCTGGG + Intronic
1034435535 7:151061234-151061256 GAAGGCACAGAAGGTGGGCATGG - Intronic
1035009461 7:155701022-155701044 GTAGGCAAAGAAGGTTGACTAGG + Intronic
1036854242 8:12228626-12228648 ATAGGCACAGAAGGGGGGTTTGG + Intergenic
1039760483 8:40569231-40569253 GTAGGGAGAGAAGGTAAGTTGGG - Intronic
1040764262 8:50888066-50888088 CCAGGCAAAGAAAGTGAGCTGGG + Intergenic
1046514853 8:115245335-115245357 CTAAGCAGAGAAGGTGAGTTTGG + Intergenic
1048462642 8:134635219-134635241 GGAGGCCCAGAAGTTCAGCTGGG - Intronic
1049465859 8:142751024-142751046 GTGGGCACAGAAGGCGGGCAGGG - Intronic
1050245201 9:3682036-3682058 ATAGCTACAGAAGGAGAGCTGGG + Intergenic
1052397047 9:27950730-27950752 GGAGGAAGAGAAGGTGAGTTAGG + Intronic
1052881352 9:33602613-33602635 GTAGGCACTGCAGGTAAGCTGGG + Intergenic
1053494965 9:38543229-38543251 GCAGGCACTGCAGGTAAGCTGGG - Exonic
1053618673 9:39794506-39794528 GTGGGCACAGAAGGGGCTCTGGG - Intergenic
1053667226 9:40324790-40324812 GTAGGCACCGCAGGTAAGCTGGG + Intronic
1053876850 9:42553868-42553890 GTGGGCACAGAAGGGGCTCTGGG - Intergenic
1053895826 9:42740837-42740859 GTGGGCACAGAAGGGGCTCTGGG + Intergenic
1054265482 9:62912923-62912945 GTGGGCACAGAAGGGGCTCTGGG + Intergenic
1054378370 9:64464818-64464840 GTAGGCACCGCAGGTAAGCTGGG + Intergenic
1054517384 9:66051493-66051515 GTAGGCACCGCAGGTAAGCTGGG - Intergenic
1058932692 9:109737124-109737146 GGAGGCACAGGAGGAAAGCTAGG + Intronic
1060247168 9:121956857-121956879 GTAAGGACAGAAGAGGAGCTGGG - Intronic
1060312744 9:122477414-122477436 GTCAGCACAGAAGGAAAGCTGGG + Exonic
1188570840 X:31583575-31583597 GTGGGTAAAGAAGGTGAGCTAGG + Intronic
1189480901 X:41391563-41391585 GTAGGTAGAGCAGGTGAGCTGGG + Intergenic
1189996636 X:46645592-46645614 GTGGGGAAAGAAGGTGAGGTTGG - Intronic
1192859269 X:75048436-75048458 GTAGTCCCAGAATGGGAGCTGGG + Intergenic
1195005903 X:100685660-100685682 ATATACACAGAAGGTTAGCTCGG + Intronic
1196834644 X:119802919-119802941 GTAGGAACAGAAGCAGACCTAGG - Intergenic
1196890190 X:120283943-120283965 GTAGTTACAGAAGGTGTGGTAGG - Intronic
1196982299 X:121228322-121228344 GTGGACACAAAAGGTGAGGTTGG - Intergenic
1197614747 X:128678862-128678884 GTATGCACATATGGTCAGCTAGG + Intergenic
1197866721 X:131026911-131026933 AAAGGCATAGAAGGTGAACTGGG + Intergenic
1198231818 X:134697132-134697154 GGAGGCAGAAAAGGTGAACTAGG - Intronic
1200052376 X:153441421-153441443 GAAGTCACTGAAGGTGACCTTGG - Intergenic
1200075471 X:153548466-153548488 TTTGGCTCAGCAGGTGAGCTGGG - Intronic
1200955254 Y:8938190-8938212 GGAGGCACAGAGAGTGAGCAAGG - Intergenic