ID: 1157324309

View in Genome Browser
Species Human (GRCh38)
Location 18:46657732-46657754
Sequence GGCTTCCGGAAGTGGCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157324302_1157324309 20 Left 1157324302 18:46657689-46657711 CCTTCTCGTTCTCTCTCTCTGCT No data
Right 1157324309 18:46657732-46657754 GGCTTCCGGAAGTGGCCTCTGGG No data
1157324305_1157324309 -4 Left 1157324305 18:46657713-46657735 CCATCTCATCAAGACTGCGGGCT No data
Right 1157324309 18:46657732-46657754 GGCTTCCGGAAGTGGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157324309 Original CRISPR GGCTTCCGGAAGTGGCCTCT GGG Intergenic
No off target data available for this crispr