ID: 1157325304

View in Genome Browser
Species Human (GRCh38)
Location 18:46664586-46664608
Sequence AAACTCTCTGGGTGGCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157325299_1157325304 -2 Left 1157325299 18:46664565-46664587 CCAACTGGGGGAATCCACGGCAA No data
Right 1157325304 18:46664586-46664608 AAACTCTCTGGGTGGCCTTGTGG No data
1157325292_1157325304 13 Left 1157325292 18:46664550-46664572 CCAGTGCTCTGGGACCCAACTGG No data
Right 1157325304 18:46664586-46664608 AAACTCTCTGGGTGGCCTTGTGG No data
1157325298_1157325304 -1 Left 1157325298 18:46664564-46664586 CCCAACTGGGGGAATCCACGGCA No data
Right 1157325304 18:46664586-46664608 AAACTCTCTGGGTGGCCTTGTGG No data
1157325291_1157325304 19 Left 1157325291 18:46664544-46664566 CCAGCTCCAGTGCTCTGGGACCC No data
Right 1157325304 18:46664586-46664608 AAACTCTCTGGGTGGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157325304 Original CRISPR AAACTCTCTGGGTGGCCTTG TGG Intergenic
No off target data available for this crispr